Incidental Mutation 'R7255:Dopey2'
ID 564229
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Name dopey family member 2
Synonyms 0610038M01Rik, 2610510B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 93711904-93810590 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 93770146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 1272 (H1272N)
Ref Sequence ENSEMBL: ENSMUSP00000044437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]
AlphaFold Q3UHQ6
Predicted Effect probably damaging
Transcript: ENSMUST00000045004
AA Change: H1272N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: H1272N

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000227156
AA Change: H1154N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Zfp160 T A 17: 21,025,487 S100T probably benign Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4882:Dopey2 UTSW 16 93752914 missense possibly damaging 0.95
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7700:Dopey2 UTSW 16 93798761 splice site probably null
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7952:Dopey2 UTSW 16 93749960 missense possibly damaging 0.93
R7956:Dopey2 UTSW 16 93771028 critical splice donor site probably null
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8061:Dopey2 UTSW 16 93749996 missense probably damaging 1.00
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
R8146:Dopey2 UTSW 16 93749939 missense possibly damaging 0.95
R8184:Dopey2 UTSW 16 93776993 missense probably benign 0.13
R8221:Dopey2 UTSW 16 93749959 missense probably benign 0.01
R8263:Dopey2 UTSW 16 93762195 missense possibly damaging 0.87
R8329:Dopey2 UTSW 16 93771787 missense probably damaging 1.00
R8555:Dopey2 UTSW 16 93771810 missense probably damaging 1.00
R8683:Dopey2 UTSW 16 93771811 missense probably damaging 0.98
R8683:Dopey2 UTSW 16 93773921 missense probably benign
R8716:Dopey2 UTSW 16 93780785 nonsense probably null
R8807:Dopey2 UTSW 16 93762085 missense probably benign 0.03
R8840:Dopey2 UTSW 16 93810117 missense probably benign 0.08
R8851:Dopey2 UTSW 16 93762510 missense probably benign 0.39
R8884:Dopey2 UTSW 16 93759662 missense probably benign
R8976:Dopey2 UTSW 16 93762081 missense probably benign 0.01
R9219:Dopey2 UTSW 16 93770296 missense probably damaging 1.00
R9238:Dopey2 UTSW 16 93749130 missense probably benign 0.14
R9284:Dopey2 UTSW 16 93760308 missense probably damaging 1.00
R9289:Dopey2 UTSW 16 93771793 missense probably damaging 1.00
R9298:Dopey2 UTSW 16 93800199 missense probably damaging 0.96
R9338:Dopey2 UTSW 16 93803560 missense probably damaging 1.00
R9346:Dopey2 UTSW 16 93780814 critical splice donor site probably null
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGTCGTTTTCCAGTGACGAG -3'
(R):5'- CTTCAGGTAGCAGGGGTAGTAG -3'

Sequencing Primer
(F):5'- TCACCACATCGAGGCTGTTGAAG -3'
(R):5'- TAGCAGGGGTAGTAGGAGCG -3'
Posted On 2019-06-26