Incidental Mutation 'R7255:Zfp160'
ID 564230
Institutional Source Beutler Lab
Gene Symbol Zfp160
Ensembl Gene ENSMUSG00000067942
Gene Name zinc finger protein 160
Synonyms 6720480D16Rik, 6720480D16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7255 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21008903-21043070 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21025487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 100 (S100T)
Ref Sequence ENSEMBL: ENSMUSP00000086191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088811] [ENSMUST00000231482] [ENSMUST00000232320] [ENSMUST00000232354] [ENSMUST00000232473] [ENSMUST00000232595] [ENSMUST00000232663]
AlphaFold E9Q459
Predicted Effect probably benign
Transcript: ENSMUST00000088811
AA Change: S100T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000086191
Gene: ENSMUSG00000067942
AA Change: S100T

DomainStartEndE-ValueType
KRAB 8 68 1.91e-29 SMART
low complexity region 100 110 N/A INTRINSIC
ZnF_C2H2 146 168 1.69e-3 SMART
ZnF_C2H2 174 196 2.91e-2 SMART
ZnF_C2H2 202 224 1.4e-4 SMART
ZnF_C2H2 230 252 3.89e-3 SMART
ZnF_C2H2 258 280 1.72e-4 SMART
ZnF_C2H2 286 308 4.94e-5 SMART
ZnF_C2H2 314 336 2.12e-4 SMART
ZnF_C2H2 342 364 1.12e-3 SMART
ZnF_C2H2 370 392 1.2e-3 SMART
ZnF_C2H2 398 420 6.42e-4 SMART
ZnF_C2H2 426 448 9.08e-4 SMART
ZnF_C2H2 454 476 1.84e-4 SMART
ZnF_C2H2 482 504 1.5e-4 SMART
ZnF_C2H2 510 532 3.44e-4 SMART
ZnF_C2H2 538 560 1.12e-3 SMART
ZnF_C2H2 566 588 2.27e-4 SMART
ZnF_C2H2 594 616 1.04e-3 SMART
ZnF_C2H2 622 644 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231482
Predicted Effect probably benign
Transcript: ENSMUST00000232320
Predicted Effect probably benign
Transcript: ENSMUST00000232354
AA Change: S100T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000232473
Predicted Effect probably benign
Transcript: ENSMUST00000232595
Predicted Effect probably benign
Transcript: ENSMUST00000232663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G A 11: 23,620,465 P145L probably benign Het
9530003J23Rik T C 10: 117,234,422 H150R probably benign Het
Aldh1a7 A G 19: 20,714,728 S234P probably damaging Het
Arhgap28 T C 17: 67,853,004 H650R probably damaging Het
Asic1 A G 15: 99,697,457 D355G probably damaging Het
Atp8b1 T A 18: 64,556,868 S598C probably damaging Het
Bcat1 C A 6: 145,032,785 E237* probably null Het
Btbd16 A T 7: 130,785,992 I114F probably benign Het
Casp2 A G 6: 42,268,907 D166G probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cpsf1 G A 15: 76,597,543 T1099M probably damaging Het
Crisp4 C A 1: 18,130,231 A116S probably damaging Het
Cyb5r3 A G 15: 83,160,165 I168T probably damaging Het
Dip2b G A 15: 100,209,627 D1407N probably benign Het
Dnajc8 A G 4: 132,551,573 K201R probably benign Het
Dock10 C T 1: 80,543,099 probably null Het
Dopey2 C A 16: 93,770,146 H1272N probably damaging Het
Dsc1 C T 18: 20,097,273 R325Q probably benign Het
Enpp1 A T 10: 24,645,315 I838K possibly damaging Het
Fcna T G 2: 25,626,028 D159A probably damaging Het
Flnc G T 6: 29,445,766 G840C probably damaging Het
Flt1 C T 5: 147,580,406 A1024T probably damaging Het
Galc T C 12: 98,246,255 K207R probably null Het
Gbp2b T A 3: 142,608,117 L386Q probably damaging Het
Gm8297 T A 14: 4,984,874 N48K probably damaging Het
Gm9639 G A 10: 77,794,538 P180L unknown Het
Inpp5a A G 7: 139,511,448 N116S probably damaging Het
Ipo9 T C 1: 135,385,988 E984G probably benign Het
Klra4 A G 6: 130,059,642 F145L probably damaging Het
Lag3 A G 6: 124,910,235 L123P probably benign Het
Med7 T A 11: 46,440,995 M139K probably damaging Het
Mfsd2a A C 4: 122,952,021 L153R possibly damaging Het
Mup9 A G 4: 60,421,337 V71A probably benign Het
Myo16 A T 8: 10,499,169 Q927L unknown Het
Myo9b T C 8: 71,290,891 Y199H probably damaging Het
Nefm A G 14: 68,116,000 F406L probably benign Het
Olfr1123 T A 2: 87,418,942 L296Q probably damaging Het
Olfr1333 A T 4: 118,829,952 F162I probably benign Het
Pamr1 T C 2: 102,611,584 F173L probably damaging Het
Pds5b T A 5: 150,796,667 D1205E probably benign Het
Plxna2 T G 1: 194,752,103 F646V probably benign Het
Pnrc1 C T 4: 33,248,045 G118D probably benign Het
Ppp1r16b T C 2: 158,761,391 F412S probably benign Het
Prcc A T 3: 87,870,091 V192E probably damaging Het
Psg19 A G 7: 18,794,048 Y257H probably benign Het
Rfx7 T G 9: 72,619,828 S1433R possibly damaging Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Sbspon G T 1: 15,883,797 C86* probably null Het
Sdhb A G 4: 140,977,418 E230G possibly damaging Het
Sema6b T C 17: 56,125,336 T581A probably benign Het
Shkbp1 G T 7: 27,342,748 T594K possibly damaging Het
Shpk A G 11: 73,199,660 S48G probably benign Het
Slc1a3 A G 15: 8,642,999 V332A possibly damaging Het
Slc25a25 T C 2: 32,421,372 E135G possibly damaging Het
Slc5a8 A T 10: 88,909,631 D367V probably damaging Het
Slco1c1 A G 6: 141,569,325 T649A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spats1 T A 17: 45,454,205 D163V probably damaging Het
Ssh2 T A 11: 77,425,593 M304K probably damaging Het
Sulf1 T A 1: 12,859,008 D166E probably benign Het
Syne1 A G 10: 5,333,446 S1540P probably damaging Het
Tcf7l1 A T 6: 72,627,347 probably null Het
Tet1 A T 10: 62,822,636 M1477K probably benign Het
Tlr5 T C 1: 182,974,316 F395S probably damaging Het
Trrap T C 5: 144,858,954 L3847P probably damaging Het
Tsks C T 7: 44,952,688 S276L probably benign Het
Uggt1 T C 1: 36,146,106 E1519G probably damaging Het
Vps13a A G 19: 16,654,339 probably null Het
Wdfy4 A G 14: 32,974,282 V2768A Het
Wdr26 A C 1: 181,181,324 I627R probably benign Het
Other mutations in Zfp160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Zfp160 APN 17 21026702 missense probably benign
IGL01019:Zfp160 APN 17 21020826 missense possibly damaging 0.68
IGL02430:Zfp160 APN 17 21025530 missense possibly damaging 0.76
R0412:Zfp160 UTSW 17 21026877 missense probably damaging 0.97
R0600:Zfp160 UTSW 17 21027006 missense probably benign 0.00
R2146:Zfp160 UTSW 17 21026982 missense probably benign 0.13
R2157:Zfp160 UTSW 17 21020828 missense probably benign 0.23
R2411:Zfp160 UTSW 17 21025745 missense possibly damaging 0.94
R2904:Zfp160 UTSW 17 21025649 missense probably benign 0.00
R4249:Zfp160 UTSW 17 21025738 missense probably benign 0.11
R4896:Zfp160 UTSW 17 21020081 missense probably benign 0.00
R5106:Zfp160 UTSW 17 21026761 missense probably damaging 0.99
R5342:Zfp160 UTSW 17 21020733 missense possibly damaging 0.95
R5352:Zfp160 UTSW 17 21026852 missense probably benign 0.02
R6193:Zfp160 UTSW 17 21026862 missense probably benign 0.24
R6230:Zfp160 UTSW 17 21026445 missense probably benign 0.38
R6753:Zfp160 UTSW 17 21020734 missense probably benign 0.02
R6928:Zfp160 UTSW 17 21041462 missense probably benign 0.04
R7040:Zfp160 UTSW 17 21026532 missense probably damaging 1.00
R7497:Zfp160 UTSW 17 21026193 missense probably benign 0.08
R7510:Zfp160 UTSW 17 21026393 missense probably benign 0.00
R7540:Zfp160 UTSW 17 21025660 nonsense probably null
R7627:Zfp160 UTSW 17 21027008 missense probably damaging 0.99
R8169:Zfp160 UTSW 17 21027036 missense probably damaging 0.97
R8240:Zfp160 UTSW 17 21026088 missense probably damaging 0.99
R8330:Zfp160 UTSW 17 21026051 missense probably damaging 1.00
R8367:Zfp160 UTSW 17 21025542 missense probably benign 0.22
R8802:Zfp160 UTSW 17 21026605 missense probably damaging 1.00
R9183:Zfp160 UTSW 17 21020092 missense possibly damaging 0.84
Z1177:Zfp160 UTSW 17 21026890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCAGAACATTCAGAATTTTGAG -3'
(R):5'- TTTCTCCAGTATGAATCTGCCG -3'

Sequencing Primer
(F):5'- GAATTTTGAGTTTCAGTGGAAAGAGC -3'
(R):5'- CCAGTATGAATCTGCCGATGATATGC -3'
Posted On 2019-06-26