Incidental Mutation 'R7371:Celsr1'
ID 572119
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Name cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms crash, Crsh, Scy
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.579) question?
Stock # R7371 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 85898929-86033777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86030674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1033 (V1033I)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000016172
AA Change: V1033I

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: V1033I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 86032414 missense probably damaging 0.99
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85902864 missense probably benign 0.00
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85916723 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85906029 critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85939134 missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6186:Celsr1 UTSW 15 85921193 missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
R7491:Celsr1 UTSW 15 86032518 missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85929872 missense probably benign 0.00
R7685:Celsr1 UTSW 15 85978732 nonsense probably null
R7741:Celsr1 UTSW 15 85979102 missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85932409 missense probably benign
R7974:Celsr1 UTSW 15 86031030 missense probably damaging 1.00
R7977:Celsr1 UTSW 15 86032993 missense probably damaging 1.00
R7987:Celsr1 UTSW 15 86032993 missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85939155 missense probably benign 0.00
R8099:Celsr1 UTSW 15 86031600 missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85902889 missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85979235 missense probably benign 0.00
R8289:Celsr1 UTSW 15 86033085 nonsense probably null
R8290:Celsr1 UTSW 15 86033085 nonsense probably null
R8292:Celsr1 UTSW 15 85907618 missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85922244 missense probably benign 0.00
R8330:Celsr1 UTSW 15 85932300 missense probably damaging 0.99
R8333:Celsr1 UTSW 15 86031414 missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 86033085 nonsense probably null
R8384:Celsr1 UTSW 15 86033085 nonsense probably null
R8452:Celsr1 UTSW 15 86033085 nonsense probably null
R8463:Celsr1 UTSW 15 86030214 missense probably damaging 1.00
R8479:Celsr1 UTSW 15 86033085 nonsense probably null
R8480:Celsr1 UTSW 15 86033085 nonsense probably null
R8493:Celsr1 UTSW 15 85938006 missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85939105 missense probably benign 0.01
R8506:Celsr1 UTSW 15 86033085 nonsense probably null
R8771:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R8891:Celsr1 UTSW 15 85937993 missense probably benign 0.01
R8905:Celsr1 UTSW 15 85904068 intron probably benign
R8924:Celsr1 UTSW 15 86032470 missense possibly damaging 0.94
R8979:Celsr1 UTSW 15 85963139 missense probably damaging 0.96
R9069:Celsr1 UTSW 15 86030571 missense possibly damaging 0.53
R9115:Celsr1 UTSW 15 85919016 missense probably damaging 1.00
R9194:Celsr1 UTSW 15 86033085 nonsense probably null
R9196:Celsr1 UTSW 15 86033085 nonsense probably null
R9198:Celsr1 UTSW 15 86033085 nonsense probably null
R9200:Celsr1 UTSW 15 86033085 nonsense probably null
R9201:Celsr1 UTSW 15 86033085 nonsense probably null
R9202:Celsr1 UTSW 15 86033085 nonsense probably null
R9203:Celsr1 UTSW 15 86033085 nonsense probably null
R9222:Celsr1 UTSW 15 85931270 missense possibly damaging 0.68
R9236:Celsr1 UTSW 15 86030850 missense probably damaging 1.00
R9384:Celsr1 UTSW 15 86033085 nonsense probably null
R9386:Celsr1 UTSW 15 85979030 missense probably damaging 1.00
R9400:Celsr1 UTSW 15 86033085 nonsense probably null
R9401:Celsr1 UTSW 15 86033085 nonsense probably null
R9415:Celsr1 UTSW 15 86033085 nonsense probably null
R9428:Celsr1 UTSW 15 85931348 missense possibly damaging 0.64
R9435:Celsr1 UTSW 15 85922334 splice site probably benign
R9493:Celsr1 UTSW 15 85901145 missense probably damaging 0.98
R9495:Celsr1 UTSW 15 86033085 nonsense probably null
R9499:Celsr1 UTSW 15 86033085 nonsense probably null
R9607:Celsr1 UTSW 15 86031028 missense
R9673:Celsr1 UTSW 15 86033085 nonsense probably null
Z1176:Celsr1 UTSW 15 85963100 missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85978851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCATTCTGGTCCAGGAGAC -3'
(R):5'- TGGCCGTGTACAACCTTTGG -3'

Sequencing Primer
(F):5'- TCCAGGAGACGGATGTGCAC -3'
(R):5'- GTGTACAACCTTTGGGCTCTCG -3'
Posted On 2019-09-13