Incidental Mutation 'R7741:Celsr1'
ID 596574
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Name cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms Scy, Adgrc1, Crsh, crash
MMRRC Submission 045797-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.634) question?
Stock # R7741 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 85783130-85918404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85863303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1243 (V1243E)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000016172
AA Change: V1243E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: V1243E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226840
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,290,551 (GRCm39) P118S probably damaging Het
Adgrl1 T A 8: 84,656,343 (GRCm39) D215E probably damaging Het
Afap1l2 T C 19: 56,902,914 (GRCm39) D755G probably damaging Het
Akr1c18 T A 13: 4,194,332 (GRCm39) D109V possibly damaging Het
Brdt G A 5: 107,506,752 (GRCm39) R445H probably benign Het
Capn2 C A 1: 182,307,288 (GRCm39) E517* probably null Het
Cenpe C G 3: 134,953,096 (GRCm39) probably null Het
Cep135 A G 5: 76,778,817 (GRCm39) E748G probably damaging Het
Cfap119 C A 7: 127,187,159 (GRCm39) V35L probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Col6a1 C A 10: 76,545,743 (GRCm39) A910S unknown Het
Cyp4a14 T A 4: 115,347,156 (GRCm39) probably null Het
Dot1l C T 10: 80,619,378 (GRCm39) R412W probably damaging Het
Dyrk2 T C 10: 118,695,594 (GRCm39) T555A probably benign Het
Foxn3 T C 12: 99,162,587 (GRCm39) N438S probably damaging Het
Gdpd5 T C 7: 99,103,001 (GRCm39) F320S probably damaging Het
Grn A G 11: 102,326,560 (GRCm39) H413R probably damaging Het
Gstm7 A T 3: 107,838,963 (GRCm39) M3K possibly damaging Het
Il17rd A G 14: 26,822,293 (GRCm39) E673G probably damaging Het
Klhl29 T C 12: 5,187,500 (GRCm39) D288G possibly damaging Het
Klk1b11 G A 7: 43,426,421 (GRCm39) A79T probably benign Het
Kmt2a A G 9: 44,719,359 (GRCm39) V3914A unknown Het
Map2k2 T C 10: 80,956,877 (GRCm39) V307A probably benign Het
Mst1r G T 9: 107,784,319 (GRCm39) probably benign Het
Nr3c2 A G 8: 77,937,275 (GRCm39) E834G probably damaging Het
Oga A T 19: 45,764,501 (GRCm39) L213H probably damaging Het
Ogfod3 T G 11: 121,074,362 (GRCm39) probably null Het
Or5b102 A T 19: 13,041,423 (GRCm39) Y216F probably damaging Het
Or8d2 T C 9: 38,759,614 (GRCm39) L68P probably damaging Het
Plscr4 A T 9: 92,364,693 (GRCm39) probably null Het
Pou2f1 A G 1: 165,703,444 (GRCm39) S749P probably damaging Het
Ppp4r3b T G 11: 29,155,701 (GRCm39) L556V possibly damaging Het
Psd4 T G 2: 24,291,108 (GRCm39) probably null Het
Rbbp4 T C 4: 129,228,356 (GRCm39) D33G probably damaging Het
Rif1 T A 2: 51,975,153 (GRCm39) M354K probably damaging Het
Rmi1 A G 13: 58,557,067 (GRCm39) K439E probably benign Het
Scgb2b7 A G 7: 31,404,454 (GRCm39) probably null Het
Sdc1 A G 12: 8,841,370 (GRCm39) D237G probably benign Het
Sel1l3 T C 5: 53,357,593 (GRCm39) Y133C probably damaging Het
Snx31 A G 15: 36,523,587 (GRCm39) probably null Het
Snx7 A G 3: 117,632,488 (GRCm39) F201S probably damaging Het
Tas2r131 C T 6: 132,934,438 (GRCm39) V124I possibly damaging Het
Tbx20 A T 9: 24,651,581 (GRCm39) probably null Het
Topbp1 A T 9: 103,197,756 (GRCm39) N445I probably damaging Het
Tpx2 T A 2: 152,709,263 (GRCm39) I31K possibly damaging Het
Trpv3 T A 11: 73,179,088 (GRCm39) V499E probably damaging Het
Tshr G A 12: 91,500,743 (GRCm39) W258* probably null Het
Usp32 G T 11: 84,878,107 (GRCm39) D1543E probably damaging Het
Usp39 A G 6: 72,315,521 (GRCm39) probably benign Het
Vac14 T C 8: 111,361,020 (GRCm39) S197P probably damaging Het
Vars2 A G 17: 35,971,835 (GRCm39) S497P probably damaging Het
Zfp462 C A 4: 55,008,637 (GRCm39) P201Q probably benign Het
Zkscan5 A G 5: 145,157,847 (GRCm39) Q783R possibly damaging Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85,815,546 (GRCm39) missense probably benign 0.04
IGL00519:Celsr1 APN 15 85,915,037 (GRCm39) missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85,806,436 (GRCm39) missense probably damaging 1.00
IGL01303:Celsr1 APN 15 85,914,692 (GRCm39) missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85,810,391 (GRCm39) missense probably benign 0.35
IGL01910:Celsr1 APN 15 85,814,096 (GRCm39) missense probably benign
IGL01931:Celsr1 APN 15 85,791,861 (GRCm39) missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85,847,424 (GRCm39) missense probably benign 0.35
IGL02090:Celsr1 APN 15 85,791,922 (GRCm39) missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85,863,205 (GRCm39) missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85,814,108 (GRCm39) missense probably benign 0.01
IGL02413:Celsr1 APN 15 85,915,427 (GRCm39) missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85,825,337 (GRCm39) missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85,784,889 (GRCm39) utr 3 prime probably benign
IGL02508:Celsr1 APN 15 85,914,818 (GRCm39) nonsense probably null
IGL02899:Celsr1 APN 15 85,915,927 (GRCm39) missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85,785,673 (GRCm39) missense probably benign
IGL03212:Celsr1 APN 15 85,814,878 (GRCm39) missense probably benign 0.04
P0028:Celsr1 UTSW 15 85,806,436 (GRCm39) missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85,785,138 (GRCm39) missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 85,916,615 (GRCm39) missense probably damaging 0.99
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85,813,620 (GRCm39) missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 85,914,963 (GRCm39) missense probably benign 0.02
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85,787,065 (GRCm39) missense probably benign 0.00
R0570:Celsr1 UTSW 15 85,787,566 (GRCm39) missense probably benign 0.18
R0611:Celsr1 UTSW 15 85,816,524 (GRCm39) missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85,785,798 (GRCm39) missense probably benign
R0792:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R0943:Celsr1 UTSW 15 85,787,489 (GRCm39) missense probably damaging 1.00
R0989:Celsr1 UTSW 15 85,915,480 (GRCm39) missense probably benign 0.39
R1118:Celsr1 UTSW 15 85,916,248 (GRCm39) missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R1239:Celsr1 UTSW 15 85,863,347 (GRCm39) missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1522:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R1662:Celsr1 UTSW 15 85,915,263 (GRCm39) missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85,816,658 (GRCm39) missense probably benign 0.00
R1795:Celsr1 UTSW 15 85,914,524 (GRCm39) missense probably damaging 0.99
R1799:Celsr1 UTSW 15 85,916,886 (GRCm39) missense probably damaging 1.00
R1858:Celsr1 UTSW 15 85,916,960 (GRCm39) missense probably damaging 1.00
R2040:Celsr1 UTSW 15 85,917,088 (GRCm39) missense probably damaging 1.00
R2050:Celsr1 UTSW 15 85,914,748 (GRCm39) missense probably benign 0.02
R2131:Celsr1 UTSW 15 85,847,424 (GRCm39) missense probably benign 0.35
R2132:Celsr1 UTSW 15 85,916,168 (GRCm39) missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85,863,431 (GRCm39) missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85,800,924 (GRCm39) missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 85,916,008 (GRCm39) missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85,863,028 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,847,334 (GRCm39) missense probably benign 0.00
R4416:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85,800,957 (GRCm39) missense probably benign 0.35
R4666:Celsr1 UTSW 15 85,914,695 (GRCm39) missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85,816,661 (GRCm39) missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85,790,230 (GRCm39) critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85,822,154 (GRCm39) missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85,822,112 (GRCm39) missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85,823,335 (GRCm39) missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85,816,585 (GRCm39) missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85,814,747 (GRCm39) missense probably benign
R5310:Celsr1 UTSW 15 85,810,423 (GRCm39) missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85,815,483 (GRCm39) missense probably benign 0.00
R5639:Celsr1 UTSW 15 85,914,968 (GRCm39) missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85,825,465 (GRCm39) missense probably benign 0.27
R5778:Celsr1 UTSW 15 85,917,156 (GRCm39) missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85,788,215 (GRCm39) missense probably benign 0.02
R5915:Celsr1 UTSW 15 85,914,550 (GRCm39) missense probably damaging 0.96
R5915:Celsr1 UTSW 15 85,822,176 (GRCm39) missense probably benign
R5932:Celsr1 UTSW 15 85,916,905 (GRCm39) missense probably damaging 1.00
R5950:Celsr1 UTSW 15 85,916,701 (GRCm39) missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85,803,239 (GRCm39) splice site probably null
R6050:Celsr1 UTSW 15 85,814,812 (GRCm39) missense probably benign 0.00
R6117:Celsr1 UTSW 15 85,816,612 (GRCm39) missense probably benign 0.04
R6178:Celsr1 UTSW 15 85,785,222 (GRCm39) missense probably benign 0.08
R6186:Celsr1 UTSW 15 85,805,394 (GRCm39) missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85,800,888 (GRCm39) missense probably benign 0.25
R6307:Celsr1 UTSW 15 85,812,531 (GRCm39) missense probably benign
R6320:Celsr1 UTSW 15 85,785,160 (GRCm39) missense probably benign 0.13
R6349:Celsr1 UTSW 15 85,915,885 (GRCm39) missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85,863,121 (GRCm39) missense probably benign 0.07
R6607:Celsr1 UTSW 15 85,847,486 (GRCm39) missense probably benign
R6615:Celsr1 UTSW 15 85,786,315 (GRCm39) critical splice donor site probably null
R6661:Celsr1 UTSW 15 85,803,135 (GRCm39) missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85,790,115 (GRCm39) critical splice donor site probably null
R6743:Celsr1 UTSW 15 85,791,799 (GRCm39) missense probably damaging 0.96
R6746:Celsr1 UTSW 15 85,915,696 (GRCm39) missense probably damaging 1.00
R6772:Celsr1 UTSW 15 85,914,983 (GRCm39) missense probably benign
R6838:Celsr1 UTSW 15 85,823,395 (GRCm39) missense probably benign
R6886:Celsr1 UTSW 15 85,915,855 (GRCm39) missense probably benign 0.00
R7030:Celsr1 UTSW 15 85,789,679 (GRCm39) missense probably damaging 0.99
R7060:Celsr1 UTSW 15 85,916,856 (GRCm39) missense probably benign 0.07
R7080:Celsr1 UTSW 15 85,816,652 (GRCm39) missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 85,917,209 (GRCm39) missense probably damaging 0.99
R7357:Celsr1 UTSW 15 85,914,715 (GRCm39) missense probably benign 0.00
R7371:Celsr1 UTSW 15 85,914,875 (GRCm39) missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85,791,874 (GRCm39) missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 85,917,593 (GRCm39) missense probably benign
R7491:Celsr1 UTSW 15 85,916,719 (GRCm39) missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85,814,073 (GRCm39) missense probably benign 0.00
R7685:Celsr1 UTSW 15 85,862,933 (GRCm39) nonsense probably null
R7768:Celsr1 UTSW 15 85,816,610 (GRCm39) missense probably benign
R7974:Celsr1 UTSW 15 85,915,231 (GRCm39) missense probably damaging 1.00
R7977:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R7987:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85,823,356 (GRCm39) missense probably benign 0.00
R8099:Celsr1 UTSW 15 85,915,801 (GRCm39) missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85,787,090 (GRCm39) missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85,863,436 (GRCm39) missense probably benign 0.00
R8289:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8290:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8292:Celsr1 UTSW 15 85,791,819 (GRCm39) missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85,806,445 (GRCm39) missense probably benign 0.00
R8330:Celsr1 UTSW 15 85,816,501 (GRCm39) missense probably damaging 0.99
R8333:Celsr1 UTSW 15 85,915,615 (GRCm39) missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8452:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8463:Celsr1 UTSW 15 85,914,415 (GRCm39) missense probably damaging 1.00
R8479:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8480:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8493:Celsr1 UTSW 15 85,822,207 (GRCm39) missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85,823,306 (GRCm39) missense probably benign 0.01
R8506:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8771:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R8891:Celsr1 UTSW 15 85,822,194 (GRCm39) missense probably benign 0.01
R8905:Celsr1 UTSW 15 85,788,269 (GRCm39) intron probably benign
R8924:Celsr1 UTSW 15 85,916,671 (GRCm39) missense possibly damaging 0.94
R8979:Celsr1 UTSW 15 85,847,340 (GRCm39) missense probably damaging 0.96
R9069:Celsr1 UTSW 15 85,914,772 (GRCm39) missense possibly damaging 0.53
R9115:Celsr1 UTSW 15 85,803,217 (GRCm39) missense probably damaging 1.00
R9194:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9196:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9198:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9200:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9201:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9202:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9203:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9222:Celsr1 UTSW 15 85,815,471 (GRCm39) missense possibly damaging 0.68
R9236:Celsr1 UTSW 15 85,915,051 (GRCm39) missense probably damaging 1.00
R9384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9386:Celsr1 UTSW 15 85,863,231 (GRCm39) missense probably damaging 1.00
R9400:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9401:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9415:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9428:Celsr1 UTSW 15 85,815,549 (GRCm39) missense possibly damaging 0.64
R9435:Celsr1 UTSW 15 85,806,535 (GRCm39) splice site probably benign
R9493:Celsr1 UTSW 15 85,785,346 (GRCm39) missense probably damaging 0.98
R9495:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9499:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9607:Celsr1 UTSW 15 85,915,229 (GRCm39) missense
R9673:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
Z1176:Celsr1 UTSW 15 85,847,301 (GRCm39) missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85,863,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTAGATCTGCTCCTGC -3'
(R):5'- TGCCAAGTACATCTAAGCTAAGGC -3'

Sequencing Primer
(F):5'- CAGGTCCTCTGACGGGAAGAAC -3'
(R):5'- GTCTCGGGCATCCTACTGACAAC -3'
Posted On 2019-11-26