Incidental Mutation 'R7587:Gpr107'
ID587188
Institutional Source Beutler Lab
Gene Symbol Gpr107
Ensembl Gene ENSMUSG00000000194
Gene NameG protein-coupled receptor 107
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location31152316-31218775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31168826 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 109 (K109N)
Ref Sequence ENSEMBL: ENSMUSP00000056739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056433]
Predicted Effect probably benign
Transcript: ENSMUST00000056433
AA Change: K109N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056739
Gene: ENSMUSG00000000194
AA Change: K109N

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lung_7-TM_R 213 504 3e-100 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes complete embryonic lethality during organogenesis, associated with reduced expression of genes implicated in the cubilin-megalin multi-ligand endocytic receptor complex. Homozygous null MEFs show defects in receptor-mediated endocytosis and recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Kdm3b A G 18: 34,797,027 probably null Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lpp A T 16: 24,762,279 probably null Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Ncbp3 T C 11: 73,066,765 probably null Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Gpr107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gpr107 APN 2 31171994 missense probably benign 0.00
IGL00828:Gpr107 APN 2 31177783 critical splice acceptor site probably null
IGL01138:Gpr107 APN 2 31172016 missense probably benign 0.06
IGL01589:Gpr107 APN 2 31167151 splice site probably benign
IGL02164:Gpr107 APN 2 31178286 nonsense probably null
IGL02176:Gpr107 APN 2 31168846 missense probably benign 0.01
IGL02190:Gpr107 APN 2 31178320 missense probably damaging 1.00
IGL02234:Gpr107 APN 2 31177833 missense probably damaging 1.00
IGL02838:Gpr107 APN 2 31214317 missense probably benign 0.01
PIT4142001:Gpr107 UTSW 2 31167071 missense probably benign 0.18
R0613:Gpr107 UTSW 2 31178285 missense probably damaging 1.00
R0630:Gpr107 UTSW 2 31214297 missense possibly damaging 0.89
R0735:Gpr107 UTSW 2 31171994 missense probably benign 0.00
R1263:Gpr107 UTSW 2 31178255 missense possibly damaging 0.82
R1572:Gpr107 UTSW 2 31167025 missense probably damaging 1.00
R1675:Gpr107 UTSW 2 31167051 missense possibly damaging 0.77
R2421:Gpr107 UTSW 2 31185529 missense probably damaging 1.00
R4569:Gpr107 UTSW 2 31207665 splice site probably benign
R4647:Gpr107 UTSW 2 31210501 missense probably damaging 1.00
R4656:Gpr107 UTSW 2 31214249 missense probably damaging 1.00
R4844:Gpr107 UTSW 2 31188674 splice site probably null
R5385:Gpr107 UTSW 2 31214251 missense probably benign 0.01
R5416:Gpr107 UTSW 2 31185548 missense probably damaging 1.00
R5562:Gpr107 UTSW 2 31152363 missense probably damaging 1.00
R5564:Gpr107 UTSW 2 31152363 missense probably damaging 1.00
R5652:Gpr107 UTSW 2 31185589 missense probably benign 0.16
R6075:Gpr107 UTSW 2 31152372 missense probably benign 0.05
R7186:Gpr107 UTSW 2 31152359 start codon destroyed possibly damaging 0.59
R7511:Gpr107 UTSW 2 31178346 missense probably benign 0.03
R7946:Gpr107 UTSW 2 31188704 missense probably damaging 1.00
R8108:Gpr107 UTSW 2 31184869 missense probably damaging 1.00
R8518:Gpr107 UTSW 2 31176927 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACTTCCCAGGCGCTAGGATTG -3'
(R):5'- CACATGGGCTCTATCTCCAG -3'

Sequencing Primer
(F):5'- CTAGGATTGCAGTGGCCTGAC -3'
(R):5'- TCTCCAGCACTCAGTGTAGGATAG -3'
Posted On2019-10-24