Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Capzb'

587199

Institutional Source

Beutler Lab

Gene Symbol

Capzb

Ensembl Gene

ENSMUSG00000028745

Gene Name

capping protein (actin filament) muscle Z-line, beta

Synonyms

1700120C01Rik, CPB2, Cappb1, CPbeta1, CPbeta2, CPB1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139192899-139291818 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139262023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 85 (D85E)

Ref Sequence

ENSEMBL: ENSMUSP00000114973 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030518] [ENSMUST00000042675] [ENSMUST00000102507] [ENSMUST00000102508] [ENSMUST00000131912] [ENSMUST00000138045] [ENSMUST00000145368]

AlphaFold

P47757

Predicted Effect

probably benign
Transcript: ENSMUST00000030518
AA Change: D114E

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000030518
Gene: ENSMUSG00000028745
AA Change: D114E

Domain	Start	End	E-Value	Type
Pfam:F_actin_cap_B	35	269	6.2e-114	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000042675
AA Change: D73E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000038011
Gene: ENSMUSG00000028745
AA Change: D73E

Domain	Start	End	E-Value	Type
Pfam:F_actin_cap_B	1	228	4.7e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102507
AA Change: D85E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000099565
Gene: ENSMUSG00000028745
AA Change: D85E

Domain	Start	End	E-Value	Type
Pfam:F_actin_cap_B	6	240	4.6e-114	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102508
AA Change: D85E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000099566
Gene: ENSMUSG00000028745
AA Change: D85E

Domain	Start	End	E-Value	Type
Pfam:F_actin_cap_B	5	240	6.8e-115	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131912
AA Change: D85E

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114973
Gene: ENSMUSG00000028745
AA Change: D85E

Domain	Start	End	E-Value	Type
Pfam:F_actin_cap_B	5	113	1.5e-53	PFAM
low complexity region	115	126	N/A	INTRINSIC
Pfam:F_actin_cap_B	143	188	4.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138045
AA Change: D73E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000122077
Gene: ENSMUSG00000028745
AA Change: D73E

Domain	Start	End	E-Value	Type
Pfam:F_actin_cap_B	1	204	9.8e-97	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145368
AA Change: D85E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000119252
Gene: ENSMUSG00000028745
AA Change: D85E

Domain	Start	End	E-Value	Type
Pfam:F_actin_cap_B	6	110	2.2e-53	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150077

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in the ear exhibit increased ABR threshold, absent DPOE, reduced vestibular function, head shaking and abnormal stereocilia length and width in the cochlea and utricle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tbce	C	T	13: 14,019,742	V111M	probably damaging	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Capzb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Capzb	APN	4	139288947	missense	probably benign	0.00
IGL00885:Capzb	APN	4	139287050	missense	probably benign	0.00
R0612:Capzb	UTSW	4	139291029	missense	probably benign
R0729:Capzb	UTSW	4	139288977	unclassified	probably benign
R1547:Capzb	UTSW	4	139262098	splice site	probably null
R1731:Capzb	UTSW	4	139280030	missense	probably damaging	1.00
R1748:Capzb	UTSW	4	139257368	missense	probably damaging	1.00
R2234:Capzb	UTSW	4	139262023	missense	possibly damaging	0.80
R2424:Capzb	UTSW	4	139194130	start codon destroyed	probably null	0.01
R4799:Capzb	UTSW	4	139192999	utr 5 prime	probably benign
R5076:Capzb	UTSW	4	139287814	missense	possibly damaging	0.85
R5596:Capzb	UTSW	4	139279427	intron	probably benign
R6200:Capzb	UTSW	4	139280013	missense	probably benign	0.33
R7763:Capzb	UTSW	4	139280553	missense	probably benign
X0012:Capzb	UTSW	4	139257291	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TGTATTAGTCAGTCTGCCGGC -3'
(R):5'- AGGGAGCTCCAACTTTTAGCAAG -3'

Sequencing Primer
(F):5'- AGTCTGCCGGCTTCTGAAC -3'
(R):5'- GAGCTCCAACTTTTAGCAAGCTAGG -3'

Posted On

2019-10-24