Incidental Mutation 'R7587:Capzb'
ID587199
Institutional Source Beutler Lab
Gene Symbol Capzb
Ensembl Gene ENSMUSG00000028745
Gene Namecapping protein (actin filament) muscle Z-line, beta
Synonyms1700120C01Rik, CPB2, Cappb1, CPbeta1, CPbeta2, CPB1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location139192899-139291818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139262023 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 85 (D85E)
Ref Sequence ENSEMBL: ENSMUSP00000114973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030518] [ENSMUST00000042675] [ENSMUST00000102507] [ENSMUST00000102508] [ENSMUST00000131912] [ENSMUST00000138045] [ENSMUST00000145368]
Predicted Effect probably benign
Transcript: ENSMUST00000030518
AA Change: D114E

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030518
Gene: ENSMUSG00000028745
AA Change: D114E

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 35 269 6.2e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042675
AA Change: D73E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000038011
Gene: ENSMUSG00000028745
AA Change: D73E

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 228 4.7e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102507
AA Change: D85E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099565
Gene: ENSMUSG00000028745
AA Change: D85E

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 6 240 4.6e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102508
AA Change: D85E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099566
Gene: ENSMUSG00000028745
AA Change: D85E

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 240 6.8e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131912
AA Change: D85E

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114973
Gene: ENSMUSG00000028745
AA Change: D85E

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 113 1.5e-53 PFAM
low complexity region 115 126 N/A INTRINSIC
Pfam:F_actin_cap_B 143 188 4.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138045
AA Change: D73E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000122077
Gene: ENSMUSG00000028745
AA Change: D73E

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 204 9.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145368
AA Change: D85E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119252
Gene: ENSMUSG00000028745
AA Change: D85E

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 6 110 2.2e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150077
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in the ear exhibit increased ABR threshold, absent DPOE, reduced vestibular function, head shaking and abnormal stereocilia length and width in the cochlea and utricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asah1 A T 8: 41,374,541 V15D probably benign Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Capzb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Capzb APN 4 139288947 missense probably benign 0.00
IGL00885:Capzb APN 4 139287050 missense probably benign 0.00
R0612:Capzb UTSW 4 139291029 missense probably benign
R0729:Capzb UTSW 4 139288977 unclassified probably benign
R1547:Capzb UTSW 4 139262098 unclassified probably null
R1731:Capzb UTSW 4 139280030 missense probably damaging 1.00
R1748:Capzb UTSW 4 139257368 missense probably damaging 1.00
R2234:Capzb UTSW 4 139262023 missense possibly damaging 0.80
R2424:Capzb UTSW 4 139194130 start codon destroyed probably null 0.01
R4799:Capzb UTSW 4 139192999 utr 5 prime probably benign
R5076:Capzb UTSW 4 139287814 missense possibly damaging 0.85
R5596:Capzb UTSW 4 139279427 intron probably benign
R6200:Capzb UTSW 4 139280013 missense probably benign 0.33
R7763:Capzb UTSW 4 139280553 missense probably benign
X0012:Capzb UTSW 4 139257291 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTATTAGTCAGTCTGCCGGC -3'
(R):5'- AGGGAGCTCCAACTTTTAGCAAG -3'

Sequencing Primer
(F):5'- AGTCTGCCGGCTTCTGAAC -3'
(R):5'- GAGCTCCAACTTTTAGCAAGCTAGG -3'
Posted On2019-10-24