Mutagenetix > Incidental Mutation

Incidental Mutation 'R7587:Tbce'

587226

Institutional Source

Beutler Lab

Gene Symbol

Tbce

Ensembl Gene

ENSMUSG00000039233

Gene Name

tubulin-specific chaperone E

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7587 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13997949-14039638 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 14019742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 111 (V111M)

Ref Sequence

ENSEMBL: ENSMUSP00000047880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039894] [ENSMUST00000159893] [ENSMUST00000162326]

AlphaFold

Q8CIV8

PDB Structure

Solution structure of the C-terminal ubiquitin-like domain of mouse tubulin-specific chaperone e [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039894
AA Change: V111M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047880
Gene: ENSMUSG00000039233
AA Change: V111M

Domain	Start	End	E-Value	Type
CAP_GLY	10	76	5.23e-32	SMART
SCOP:d1fqva2	117	345	4e-20	SMART
low complexity region	347	360	N/A	INTRINSIC
Pfam:Ubiquitin_2	442	523	1.1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159893

SMART Domains

Protein: ENSMUSP00000125244
Gene: ENSMUSG00000039233

Domain	Start	End	E-Value	Type
SCOP:d1lpla_	9	35	3e-5	SMART
Blast:CAP_GLY	10	34	2e-10	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000162326
AA Change: V111M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125613
Gene: ENSMUSG00000039233
AA Change: V111M

Domain	Start	End	E-Value	Type
CAP_GLY	10	76	5.23e-32	SMART
SCOP:d1fqva2	117	345	4e-21	SMART
low complexity region	347	360	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: This gene encodes a tubulin binding cofactor that participates in microtubule dynamics. A mouse model of progressive motor neuropathy (pmn) was discovered to harbor a single amino acid deletion in this gene. Mice that are homozygous for pmn allele exhibit progressive atrophy and premature death due to respiratory failure. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive caudal-cranial motor neuron degeneration, beginning around 3 weeks and culminating in death due to respiratory paralysis by 7 weeks. The sciatic and phrenic nerves are especially affected. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,792,087	T131A	probably damaging	Het
Asah1	A	T	8: 41,374,541	V15D	probably benign	Het
Asic1	A	C	15: 99,695,590	Q276P	probably damaging	Het
Atl2	A	T	17: 79,865,067	V158E	probably benign	Het
Atrn	T	A	2: 130,980,114	I909N	probably damaging	Het
BC034090	A	G	1: 155,217,486	V742A	probably damaging	Het
Capzb	T	A	4: 139,262,023	D85E	possibly damaging	Het
Cdh20	T	C	1: 104,941,279	F165S	probably damaging	Het
Cfap44	A	G	16: 44,404,106	E59G	probably benign	Het
Clpsl2	G	A	17: 28,549,541	V10I	probably benign	Het
D630003M21Rik	T	C	2: 158,196,388	Y1046C	probably benign	Het
D630003M21Rik	T	A	2: 158,201,056	S855C	probably damaging	Het
D6Wsu163e	A	G	6: 126,955,896	I361V	probably benign	Het
Dchs2	A	G	3: 83,304,515	I1874V	probably benign	Het
Dennd2a	T	G	6: 39,483,135	K679Q	probably damaging	Het
Dio2	A	G	12: 90,729,560	V218A	probably benign	Het
Fam208b	T	C	13: 3,568,849	K2251E	possibly damaging	Het
Gm3286	A	G	5: 95,521,411	T100A	probably damaging	Het
Gpr107	A	T	2: 31,168,826	K109N	probably benign	Het
Gpr108	C	T	17: 57,236,732	R448Q	probably damaging	Het
Gucy2c	A	G	6: 136,704,290	V932A	probably damaging	Het
Kcnj8	T	C	6: 142,566,339	T181A	probably damaging	Het
Kdm3b	A	G	18: 34,797,027		probably null	Het
Lipc	A	G	9: 70,818,924	Y168H	probably damaging	Het
Lipi	C	T	16: 75,550,215	V439M	probably benign	Het
Lpp	A	T	16: 24,762,279		probably null	Het
Lrp1b	T	G	2: 40,730,717	D3583A		Het
Ltbr	T	C	6: 125,312,352	T165A	probably benign	Het
Mroh3	A	G	1: 136,190,998	I527T	probably benign	Het
Mylk	A	G	16: 34,922,517	E1133G	probably benign	Het
Nat3	T	C	8: 67,547,574	I35T	probably damaging	Het
Ncbp3	T	C	11: 73,066,765		probably null	Het
Nedd1	G	A	10: 92,698,730	T306M	probably benign	Het
Nexn	T	C	3: 152,247,178	R316G	probably benign	Het
Nox4	A	G	7: 87,317,302	H207R	probably damaging	Het
Nsun6	T	C	2: 15,039,825	Q110R	probably benign	Het
Olfr22-ps1	C	T	11: 73,955,184	Q165*	probably null	Het
Olfr668	C	T	7: 104,925,056	R236H	probably benign	Het
Olfr851	T	A	9: 19,497,522	V258E	probably damaging	Het
Pappa2	T	C	1: 158,851,131	D905G	probably damaging	Het
Pepd	T	C	7: 34,969,540	L195S	probably damaging	Het
Pms1	A	G	1: 53,207,316	S355P	probably benign	Het
Pop1	A	T	15: 34,502,413	K82M	probably damaging	Het
Ppp1r9b	T	A	11: 95,001,940	D655E	possibly damaging	Het
Ppt2	A	G	17: 34,626,803		probably null	Het
Prss35	T	A	9: 86,755,374	C66S	probably damaging	Het
Rfc3	A	T	5: 151,651,151	M1K	probably null	Het
Rffl	T	C	11: 82,810,148	D284G	probably damaging	Het
Robo3	T	C	9: 37,429,646	D110G	probably damaging	Het
Rtel1	G	A	2: 181,322,315	V36M	probably damaging	Het
Slc1a7	T	A	4: 108,010,486	I457K	possibly damaging	Het
Smco1	A	G	16: 32,273,723	M71V	probably benign	Het
Snrnp200	G	A	2: 127,227,902	S989N	probably damaging	Het
Spef2	T	A	15: 9,713,219	I356F	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Tada2b	T	C	5: 36,476,767	I156V	probably benign	Het
Tlnrd1	A	G	7: 83,882,947	L92P	probably damaging	Het
Tnr	T	A	1: 159,886,208	D735E	probably benign	Het
Tram1	T	C	1: 13,579,547	H110R	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Unc5b	C	T	10: 60,783,120	C81Y	probably damaging	Het
Vps13a	G	A	19: 16,703,789	T1041M	probably benign	Het

Other mutations in Tbce

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Tbce	APN	13	14009740	splice site	probably benign
IGL01405:Tbce	APN	13	14003695	missense	probably damaging	1.00
IGL03142:Tbce	APN	13	14019864	missense	possibly damaging	0.90
R0362:Tbce	UTSW	13	13998162	missense	probably benign	0.12
R1736:Tbce	UTSW	13	14009642	missense	possibly damaging	0.64
R1845:Tbce	UTSW	13	14019709	missense	probably benign	0.22
R4445:Tbce	UTSW	13	13998395	missense	possibly damaging	0.82
R4803:Tbce	UTSW	13	14019861	missense	probably damaging	1.00
R4860:Tbce	UTSW	13	14019795	missense	probably damaging	0.97
R4860:Tbce	UTSW	13	14019795	missense	probably damaging	0.97
R4862:Tbce	UTSW	13	13998419	missense	possibly damaging	0.94
R5096:Tbce	UTSW	13	14029405	splice site	probably benign
R5391:Tbce	UTSW	13	14005965	missense	probably damaging	0.99
R6050:Tbce	UTSW	13	13998434	missense	possibly damaging	0.82
R6179:Tbce	UTSW	13	14019777	missense	probably benign
R6645:Tbce	UTSW	13	14005229	missense	probably benign	0.04
R7062:Tbce	UTSW	13	14019795	missense	possibly damaging	0.89
R7222:Tbce	UTSW	13	13998150	missense	probably damaging	1.00
R7572:Tbce	UTSW	13	14010587	missense	probably benign
R7726:Tbce	UTSW	13	14029290	missense	probably damaging	1.00
R7747:Tbce	UTSW	13	14006478	missense	possibly damaging	0.93
R8846:Tbce	UTSW	13	14019700	critical splice donor site	probably null
R9185:Tbce	UTSW	13	13998442	missense	probably damaging	1.00
R9299:Tbce	UTSW	13	14019813	missense	probably benign	0.00
R9337:Tbce	UTSW	13	14019813	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAATCAGTGCTGTGTTCTCCAC -3'
(R):5'- AGAGCCTTGTCAGGTCTGAAG -3'

Sequencing Primer
(F):5'- GTTCTCCACATTTTAAGCCACTAAGG -3'
(R):5'- CACATATCTGGGATTGCAGGC -3'

Posted On

2019-10-24