Incidental Mutation 'R0240:Tnfrsf21'
ID 59358
Institutional Source Beutler Lab
Gene Symbol Tnfrsf21
Ensembl Gene ENSMUSG00000023915
Gene Name tumor necrosis factor receptor superfamily, member 21
Synonyms DR6, TR7, Death receptor 6
MMRRC Submission 038478-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R0240 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 43016555-43089188 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43038213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 239 (H239Y)
Ref Sequence ENSEMBL: ENSMUSP00000024708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024708]
AlphaFold Q9EPU5
Predicted Effect probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

DomainStartEndE-ValueType
TNFR 50 88 1.58e1 SMART
TNFR 91 131 3.42e-3 SMART
TNFR 133 168 9.31e-5 SMART
TNFR 171 211 1.1e-1 SMART
transmembrane domain 351 370 N/A INTRINSIC
DEATH 393 498 1.41e-22 SMART
low complexity region 511 526 N/A INTRINSIC
low complexity region 562 575 N/A INTRINSIC
PDB:2DBH|A 576 655 5e-48 PDB
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,768,402 probably benign Het
Acsf3 T C 8: 122,780,181 L71P probably damaging Het
Adamts2 A T 11: 50,775,374 D399V probably damaging Het
Adck2 T A 6: 39,583,818 V380E probably benign Het
Alg11 T A 8: 22,065,452 V243D possibly damaging Het
Ankrd27 T A 7: 35,619,439 L585Q probably damaging Het
Atp7a T A X: 106,109,841 N1117K probably damaging Het
Cacna1b G A 2: 24,638,657 probably benign Het
Cacna1d T A 14: 30,096,969 M1210L probably benign Het
Cacna1s T C 1: 136,073,496 probably benign Het
Ccdc155 C T 7: 45,200,251 A83T probably benign Het
Chd7 T C 4: 8,852,670 probably benign Het
Col12a1 A T 9: 79,652,033 S1858T probably benign Het
Cotl1 C T 8: 119,840,324 W26* probably null Het
Csmd3 T C 15: 47,629,239 T3000A probably benign Het
Dcp1a T A 14: 30,484,594 probably benign Het
Ddhd2 A T 8: 25,739,590 probably null Het
Dnah8 T C 17: 30,765,679 I3117T probably damaging Het
Dnm3 G T 1: 162,353,625 Q162K probably benign Het
Dpy19l2 G T 9: 24,658,580 A359D probably damaging Het
Ece1 T A 4: 137,949,435 probably benign Het
Eif4g3 A G 4: 138,170,562 K1025R probably damaging Het
Eml2 C A 7: 19,184,872 Y82* probably null Het
Eml6 A G 11: 29,792,367 V1057A possibly damaging Het
Eral1 A G 11: 78,076,058 probably benign Het
Espl1 T C 15: 102,312,541 S911P probably benign Het
Fbxo8 A G 8: 56,590,261 probably benign Het
Flrt1 A T 19: 7,097,110 probably benign Het
Fndc7 A G 3: 108,858,919 probably benign Het
G3bp1 G A 11: 55,492,028 G139D probably damaging Het
Gabra6 C T 11: 42,314,947 V351I probably benign Het
Galc A T 12: 98,252,034 H186Q probably damaging Het
Ganab A G 19: 8,912,813 D702G possibly damaging Het
Gm13762 A T 2: 88,973,396 L165Q probably damaging Het
Hdac10 T C 15: 89,125,882 E291G possibly damaging Het
Hectd3 T G 4: 117,002,613 V749G probably damaging Het
Kcnh1 T A 1: 192,505,340 I703N probably benign Het
Kcnma1 G A 14: 23,494,579 T505I probably damaging Het
Kctd11 A G 11: 69,879,814 C133R probably damaging Het
Lama3 A T 18: 12,539,823 probably null Het
Lamb3 T C 1: 193,335,027 L842P probably damaging Het
Ldlr T C 9: 21,737,999 probably benign Het
Lipk G A 19: 34,046,810 R336H probably benign Het
Lrrc24 T A 15: 76,723,209 D58V probably damaging Het
Lrsam1 A G 2: 32,955,185 L106P probably damaging Het
Milr1 G A 11: 106,754,896 W88* probably null Het
Mmp10 A G 9: 7,506,543 D340G probably damaging Het
Mybpc1 T A 10: 88,555,738 Y285F possibly damaging Het
Ncoa3 A G 2: 166,054,400 T408A probably benign Het
Nefm T A 14: 68,121,134 K484* probably null Het
Nfasc A G 1: 132,601,983 S814P probably damaging Het
Nlrp4a T C 7: 26,462,516 V863A probably benign Het
Nos1 C T 5: 117,867,883 P223S probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1440 A T 19: 12,394,963 E233D probably benign Het
Olfr155 T A 4: 43,854,512 S68T probably damaging Het
Olfr228 A G 2: 86,483,386 S119P possibly damaging Het
Osbpl5 T C 7: 143,741,669 probably null Het
Otog C A 7: 46,264,032 probably null Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Pbx1 G A 1: 168,203,482 T189I possibly damaging Het
Pcnx T C 12: 81,947,018 I908T possibly damaging Het
Pdxdc1 A T 16: 13,879,445 W124R probably damaging Het
Phex C A X: 157,186,218 D587Y probably damaging Het
Plcb3 A T 19: 6,962,995 D435E probably benign Het
Plce1 A C 19: 38,728,886 K1373T probably damaging Het
Prkcd G A 14: 30,602,088 A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 S421T probably benign Het
Ptprs T C 17: 56,436,087 probably null Het
Qrich1 A G 9: 108,534,134 D286G probably damaging Het
Rcc1 C A 4: 132,332,915 G393V probably damaging Het
Reln T C 5: 22,106,045 N290S probably benign Het
Rgl1 T C 1: 152,554,424 probably benign Het
Rhpn1 C T 15: 75,714,122 T628I probably benign Het
Rilp A G 11: 75,510,921 R176G probably benign Het
Riok3 C T 18: 12,155,227 A487V probably benign Het
Rnf224 T C 2: 25,236,207 T45A probably damaging Het
Rpa1 A G 11: 75,328,687 V137A probably benign Het
Rps6ka1 C A 4: 133,848,531 Q693H probably benign Het
Scn2a G T 2: 65,735,774 V1381F probably benign Het
Scp2 T A 4: 108,098,078 H112L probably benign Het
Sdk1 T C 5: 141,998,747 W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 V408F probably damaging Het
Slc28a2 T A 2: 122,454,527 I332N probably benign Het
Slc37a3 A G 6: 39,337,238 V480A probably benign Het
Slc45a4 T A 15: 73,581,906 E674D probably benign Het
Smpd3 T C 8: 106,265,156 E255G probably damaging Het
Snx29 C T 16: 11,660,553 R658W probably damaging Het
Sppl2a A T 2: 126,920,336 M275K probably benign Het
Stac T C 9: 111,635,021 N59S probably damaging Het
Stk25 A T 1: 93,627,060 L131Q probably damaging Het
Tep1 C T 14: 50,863,029 probably benign Het
Thbs1 C A 2: 118,114,393 N229K probably damaging Het
Tmx2 A T 2: 84,675,842 H89Q probably damaging Het
Tradd T C 8: 105,259,292 N209S possibly damaging Het
Trappc3l A T 10: 34,098,932 R119* probably null Het
Trmt1l G A 1: 151,457,454 probably benign Het
Ublcp1 G T 11: 44,458,277 Y243* probably null Het
Uhrf1bp1 T A 17: 27,895,870 probably benign Het
Usp24 C A 4: 106,414,404 C2158* probably null Het
Usp34 A T 11: 23,433,206 K2088N probably damaging Het
Vmn1r53 G C 6: 90,223,943 S133C probably damaging Het
Vmn2r52 A G 7: 10,159,400 V604A probably damaging Het
Vmn2r93 A G 17: 18,304,799 K240E probably benign Het
Wdr13 T G X: 8,128,045 D242A probably damaging Het
Wwp1 C T 4: 19,641,734 probably null Het
Zan G A 5: 137,398,362 H4311Y unknown Het
Zc3h12c C A 9: 52,144,083 R123L possibly damaging Het
Zfp125 A T 12: 20,900,561 noncoding transcript Het
Zfp318 C T 17: 46,396,813 P266S probably benign Het
Other mutations in Tnfrsf21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Tnfrsf21 APN 17 43037946 missense probably damaging 1.00
IGL01663:Tnfrsf21 APN 17 43087811 missense probably benign 0.13
IGL01811:Tnfrsf21 APN 17 43037613 missense probably benign
IGL01916:Tnfrsf21 APN 17 43039803 missense probably benign 0.00
IGL01934:Tnfrsf21 APN 17 43065187 missense probably benign 0.15
IGL02184:Tnfrsf21 APN 17 43085463 missense probably benign 0.37
IGL02292:Tnfrsf21 APN 17 43039911 missense probably benign
IGL02385:Tnfrsf21 APN 17 43040051 missense probably damaging 1.00
IGL02710:Tnfrsf21 APN 17 43087929 missense probably damaging 0.97
IGL03001:Tnfrsf21 APN 17 43087895 missense probably damaging 0.99
IGL03003:Tnfrsf21 APN 17 43039943 missense probably damaging 1.00
PIT4480001:Tnfrsf21 UTSW 17 43037911 missense probably benign 0.00
R0007:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0046:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0088:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0091:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0102:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0103:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0105:Tnfrsf21 UTSW 17 43040191 critical splice donor site probably null
R0206:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0211:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0243:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0308:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0363:Tnfrsf21 UTSW 17 43037877 missense probably benign 0.01
R0456:Tnfrsf21 UTSW 17 43038091 missense probably benign 0.01
R0522:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0523:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0525:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0528:Tnfrsf21 UTSW 17 43037614 missense probably benign
R0543:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0549:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0550:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0699:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0724:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0734:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0847:Tnfrsf21 UTSW 17 43038213 missense probably benign
R0880:Tnfrsf21 UTSW 17 43037842 nonsense probably null
R1591:Tnfrsf21 UTSW 17 43085374 missense probably benign 0.01
R2069:Tnfrsf21 UTSW 17 43037938 missense possibly damaging 0.67
R2153:Tnfrsf21 UTSW 17 43087872 missense probably damaging 1.00
R2323:Tnfrsf21 UTSW 17 43085529 nonsense probably null
R3941:Tnfrsf21 UTSW 17 43038010 missense probably damaging 1.00
R4438:Tnfrsf21 UTSW 17 43087842 missense possibly damaging 0.49
R4509:Tnfrsf21 UTSW 17 43085388 missense probably benign 0.00
R4510:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4511:Tnfrsf21 UTSW 17 43065019 missense probably damaging 0.98
R4708:Tnfrsf21 UTSW 17 43038232 missense possibly damaging 0.66
R4721:Tnfrsf21 UTSW 17 43085504 missense probably damaging 1.00
R4811:Tnfrsf21 UTSW 17 43037730 missense probably benign 0.00
R5437:Tnfrsf21 UTSW 17 43037862 missense possibly damaging 0.55
R5767:Tnfrsf21 UTSW 17 43037659 missense probably damaging 0.98
R6057:Tnfrsf21 UTSW 17 43039715 missense possibly damaging 0.86
R6392:Tnfrsf21 UTSW 17 43017088 missense probably benign 0.00
R6860:Tnfrsf21 UTSW 17 43017066 missense probably benign
R7253:Tnfrsf21 UTSW 17 43037667 missense probably benign 0.00
R7288:Tnfrsf21 UTSW 17 43037818 missense possibly damaging 0.86
R7643:Tnfrsf21 UTSW 17 43037916 missense probably benign 0.00
R7937:Tnfrsf21 UTSW 17 43037925 missense probably benign 0.01
R8098:Tnfrsf21 UTSW 17 43039899 missense probably benign
R8495:Tnfrsf21 UTSW 17 43038237 missense probably benign
R8865:Tnfrsf21 UTSW 17 43085481 missense probably damaging 1.00
R8991:Tnfrsf21 UTSW 17 43085408 missense probably benign 0.03
R9088:Tnfrsf21 UTSW 17 43037716 missense probably damaging 1.00
R9150:Tnfrsf21 UTSW 17 43087800 missense probably damaging 1.00
R9220:Tnfrsf21 UTSW 17 43087910 missense probably damaging 1.00
V3553:Tnfrsf21 UTSW 17 43037931 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAAAGCTCACACGGACTGTCTGG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'
Posted On 2013-07-11