Incidental Mutation 'RF002:Nacc1'
ID 602566
Institutional Source Beutler Lab
Gene Symbol Nacc1
Ensembl Gene ENSMUSG00000001910
Gene Name nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Synonyms Btbd14b, 2010001H03Rik, 4930511N13Rik, Nac1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 84670483-84687862 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84676219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 315 (E315G)
Ref Sequence ENSEMBL: ENSMUSP00000001975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001975]
AlphaFold Q7TSZ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000001975
AA Change: E315G

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001975
Gene: ENSMUSG00000001910
AA Change: E315G

DomainStartEndE-ValueType
BTB 30 124 4.05e-25 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 224 235 N/A INTRINSIC
low complexity region 252 264 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
BEN 382 457 6.4e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ protein family. BTB/POZ proteins are involved in several cellular processes including proliferation, apoptosis and transcription regulation. The encoded protein is a transcriptional repressor that plays a role in stem cell self-renewal and pluripotency maintenance. The encoded protein also suppresses transcription of the candidate tumor suppressor Gadd45GIP1, and expression of this gene may play a role in the progression of multiple types of cancer. A pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cocaine and amphetamine. Mice homozygous for a different knock-out allele exhibit thoracic vertebral transformation and loss of the sixth lumbar vertebrae with decreaed rib number and reduced chondrocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Nacc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0052:Nacc1 UTSW 8 84676225 missense probably benign 0.00
R0069:Nacc1 UTSW 8 84677199 missense probably damaging 1.00
R0145:Nacc1 UTSW 8 84674875 splice site probably benign
R0732:Nacc1 UTSW 8 84676201 missense probably damaging 0.96
R1966:Nacc1 UTSW 8 84676381 missense probably damaging 1.00
R2064:Nacc1 UTSW 8 84673118 missense probably benign 0.18
R3709:Nacc1 UTSW 8 84677199 missense probably damaging 1.00
R4409:Nacc1 UTSW 8 84673044 makesense probably null
R5428:Nacc1 UTSW 8 84676154 missense probably damaging 1.00
R6014:Nacc1 UTSW 8 84675071 missense possibly damaging 0.93
R6341:Nacc1 UTSW 8 84674791 missense probably benign 0.09
R6862:Nacc1 UTSW 8 84673215 missense probably damaging 1.00
R7288:Nacc1 UTSW 8 84676545 missense probably benign
R7594:Nacc1 UTSW 8 84675002 missense probably damaging 0.99
R8499:Nacc1 UTSW 8 84676716 missense probably damaging 1.00
R9052:Nacc1 UTSW 8 84676748 missense probably damaging 1.00
Z1088:Nacc1 UTSW 8 84673286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAGTGTCAAGTGCCCTG -3'
(R):5'- GAGCAGTACCGTCAGATCTG -3'

Sequencing Primer
(F):5'- TGTCAAGTGCCCTGGGACAC -3'
(R):5'- GCAGTACCGTCAGATCTGCAATATG -3'
Posted On 2019-12-04