Incidental Mutation 'RF002:E4f1'
Institutional Source Beutler Lab
Gene Symbol E4f1
Ensembl Gene ENSMUSG00000024137
Gene NameE4F transcription factor 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF002 (G1)
Quality Score169.468
Status Not validated
Chromosomal Location24443778-24470313 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCG to CCGACG at 24455186 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000056032] [ENSMUST00000226654] [ENSMUST00000226754] [ENSMUST00000226941]
Predicted Effect probably benign
Transcript: ENSMUST00000056032
SMART Domains Protein: ENSMUSP00000062344
Gene: ENSMUSG00000024137

low complexity region 6 35 N/A INTRINSIC
ZnF_C2H2 57 82 3.95e1 SMART
low complexity region 84 99 N/A INTRINSIC
ZnF_C2H2 193 215 1.03e-2 SMART
ZnF_C2H2 221 243 7.37e-4 SMART
ZnF_C2H2 249 269 5.62e0 SMART
low complexity region 295 311 N/A INTRINSIC
ZnF_C2H2 433 455 5.9e-3 SMART
ZnF_C2H2 461 483 2.4e-3 SMART
ZnF_C2H2 489 511 2.49e-1 SMART
ZnF_C2H2 517 539 1.82e-3 SMART
ZnF_C2H2 545 567 1.56e-2 SMART
ZnF_C2H2 573 593 2.06e1 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
low complexity region 703 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226654
Predicted Effect probably benign
Transcript: ENSMUST00000226754
Predicted Effect probably benign
Transcript: ENSMUST00000226941
Predicted Effect probably benign
Transcript: ENSMUST00000228882
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the GLI-Kruppel zinc finger family. The encoded protein is likely to be multi-functional, with both adenovirus E1A-regulated transcription factor and ubiquitin E3 ligase activities, including roles in cell cycle regulation and the ubiquitination of p53. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display early embryonic lethality with mitotic progression failure and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in E4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:E4f1 APN 17 24444234 missense probably damaging 0.99
IGL02306:E4f1 APN 17 24446929 missense probably damaging 1.00
IGL03219:E4f1 APN 17 24445445 critical splice donor site probably null
FR4342:E4f1 UTSW 17 24455197 unclassified probably benign
FR4737:E4f1 UTSW 17 24455192 unclassified probably benign
R0084:E4f1 UTSW 17 24444082 missense possibly damaging 0.79
R0179:E4f1 UTSW 17 24451437 missense possibly damaging 0.57
R1171:E4f1 UTSW 17 24451549 missense probably damaging 1.00
R1773:E4f1 UTSW 17 24446584 missense probably damaging 1.00
R4531:E4f1 UTSW 17 24445987 missense possibly damaging 0.56
R5243:E4f1 UTSW 17 24447318 missense probably damaging 1.00
R5430:E4f1 UTSW 17 24444970 missense probably damaging 1.00
R5543:E4f1 UTSW 17 24447362 missense possibly damaging 0.49
R5598:E4f1 UTSW 17 24447129 missense probably damaging 1.00
R5604:E4f1 UTSW 17 24444144 missense probably damaging 1.00
R5858:E4f1 UTSW 17 24445328 missense probably damaging 1.00
R6240:E4f1 UTSW 17 24444582 missense possibly damaging 0.54
R6703:E4f1 UTSW 17 24447131 missense probably damaging 1.00
R7108:E4f1 UTSW 17 24444578 missense probably damaging 0.96
R7122:E4f1 UTSW 17 24444834 nonsense probably null
R7240:E4f1 UTSW 17 24444325 missense probably damaging 1.00
R7604:E4f1 UTSW 17 24455233 missense unknown
R7648:E4f1 UTSW 17 24445448 missense probably benign 0.02
R8357:E4f1 UTSW 17 24446527 missense probably benign 0.39
R8457:E4f1 UTSW 17 24446527 missense probably benign 0.39
R8769:E4f1 UTSW 17 24444600 missense probably damaging 1.00
RF011:E4f1 UTSW 17 24455186 unclassified probably benign
RF020:E4f1 UTSW 17 24455195 unclassified probably benign
RF023:E4f1 UTSW 17 24455183 unclassified probably benign
RF028:E4f1 UTSW 17 24455190 unclassified probably benign
RF033:E4f1 UTSW 17 24455183 unclassified probably benign
RF035:E4f1 UTSW 17 24455190 unclassified probably benign
RF035:E4f1 UTSW 17 24455195 unclassified probably benign
Z1176:E4f1 UTSW 17 24446145 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04