Incidental Mutation 'RF002:Vmn2r56'
Institutional Source Beutler Lab
Gene Symbol Vmn2r56
Ensembl Gene ENSMUSG00000090762
Gene Namevomeronasal 2, receptor 56
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #RF002 (G1)
Quality Score91.0077
Status Not validated
Chromosomal Location12693998-12733105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12694830 bp
Amino Acid Change Threonine to Isoleucine at position 503 (T503I)
Ref Sequence ENSEMBL: ENSMUSP00000129566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163852]
AlphaFold A0A3B2WBA1
Predicted Effect probably benign
Transcript: ENSMUST00000163852
AA Change: T503I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129566
Gene: ENSMUSG00000090762
AA Change: T503I

Pfam:ANF_receptor 5 397 1.9e-55 PFAM
Pfam:NCD3G 439 492 6.4e-20 PFAM
Pfam:7tm_3 523 760 1.3e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Vmn2r56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Vmn2r56 APN 7 12715499 missense probably benign 0.38
IGL01060:Vmn2r56 APN 7 12713089 missense probably damaging 0.97
IGL01433:Vmn2r56 APN 7 12715614 missense probably benign
IGL01859:Vmn2r56 APN 7 12716005 missense probably damaging 1.00
IGL01874:Vmn2r56 APN 7 12715675 missense probably benign 0.03
IGL02208:Vmn2r56 APN 7 12715481 missense probably benign 0.01
PIT4445001:Vmn2r56 UTSW 7 12715226 critical splice donor site probably null
R0077:Vmn2r56 UTSW 7 12715405 missense probably benign 0.01
R0278:Vmn2r56 UTSW 7 12715717 missense probably damaging 0.99
R0512:Vmn2r56 UTSW 7 12715423 missense probably benign
R0658:Vmn2r56 UTSW 7 12710308 missense probably benign 0.10
R0789:Vmn2r56 UTSW 7 12732835 missense probably damaging 1.00
R1534:Vmn2r56 UTSW 7 12694027 missense probably benign
R1731:Vmn2r56 UTSW 7 12733045 missense probably benign
R1817:Vmn2r56 UTSW 7 12715615 missense probably benign
R2047:Vmn2r56 UTSW 7 12732991 missense probably damaging 1.00
R2139:Vmn2r56 UTSW 7 12712963 nonsense probably null
R2160:Vmn2r56 UTSW 7 12694219 missense probably benign 0.43
R2449:Vmn2r56 UTSW 7 12694155 missense possibly damaging 0.67
R2877:Vmn2r56 UTSW 7 12711027 missense probably benign
R2878:Vmn2r56 UTSW 7 12711027 missense probably benign
R4910:Vmn2r56 UTSW 7 12715535 missense possibly damaging 0.64
R5072:Vmn2r56 UTSW 7 12694056 missense probably benign 0.40
R5340:Vmn2r56 UTSW 7 12715872 missense probably damaging 1.00
R5697:Vmn2r56 UTSW 7 12715990 missense probably damaging 1.00
R5798:Vmn2r56 UTSW 7 12712965 missense probably benign 0.00
R6166:Vmn2r56 UTSW 7 12694020 missense probably damaging 1.00
R6290:Vmn2r56 UTSW 7 12694882 missense probably damaging 1.00
R6458:Vmn2r56 UTSW 7 12694057 missense probably damaging 0.99
R6751:Vmn2r56 UTSW 7 12694792 missense probably benign
R6978:Vmn2r56 UTSW 7 12715406 missense probably benign 0.01
R7090:Vmn2r56 UTSW 7 12715327 missense probably damaging 1.00
R7200:Vmn2r56 UTSW 7 12710332 missense probably damaging 1.00
R7861:Vmn2r56 UTSW 7 12715424 missense probably benign 0.00
R8222:Vmn2r56 UTSW 7 12711033 missense probably benign
R8282:Vmn2r56 UTSW 7 12715674 nonsense probably null
R8786:Vmn2r56 UTSW 7 12715466 missense probably damaging 1.00
R8970:Vmn2r56 UTSW 7 12694705 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04