Incidental Mutation 'RF021:Gm6614'
ID603878
Institutional Source Beutler Lab
Gene Symbol Gm6614
Ensembl Gene ENSMUSG00000079263
Gene Namepredicted gene 6614
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location141971845-142011414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142008714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 31 (V31E)
Ref Sequence ENSEMBL: ENSMUSP00000137967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111832] [ENSMUST00000181628] [ENSMUST00000181791]
Predicted Effect probably damaging
Transcript: ENSMUST00000111832
AA Change: V11E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107463
Gene: ENSMUSG00000079263
AA Change: V11E

DomainStartEndE-ValueType
Pfam:OATP 1 577 2.5e-156 PFAM
Pfam:MFS_1 125 402 1e-23 PFAM
Pfam:Kazal_2 425 466 4.1e-9 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181628
AA Change: V31E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137967
Gene: ENSMUSG00000079263
AA Change: V31E

DomainStartEndE-ValueType
Pfam:OATP 19 598 2.8e-187 PFAM
Pfam:MFS_1 145 422 8e-24 PFAM
Pfam:Kazal_2 445 486 1.1e-7 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181791
AA Change: V11E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137696
Gene: ENSMUSG00000079263
AA Change: V11E

DomainStartEndE-ValueType
Pfam:OATP 1 578 2.3e-186 PFAM
Pfam:MFS_1 125 402 8.6e-24 PFAM
Pfam:Kazal_2 425 466 1.4e-7 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Gm6614
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Gm6614 APN 6 141990408 missense probably benign 0.00
IGL01548:Gm6614 APN 6 141992512 missense possibly damaging 0.82
IGL01552:Gm6614 APN 6 141987706 missense possibly damaging 0.54
IGL02207:Gm6614 APN 6 141990432 missense possibly damaging 0.80
IGL02227:Gm6614 APN 6 141993675 nonsense probably null
IGL02547:Gm6614 APN 6 141990390 missense probably damaging 0.99
IGL02678:Gm6614 APN 6 142008718 missense probably damaging 1.00
IGL02695:Gm6614 APN 6 141987760 missense probably damaging 1.00
IGL02851:Gm6614 APN 6 142003471 missense probably damaging 1.00
IGL02881:Gm6614 APN 6 141972243 missense probably benign 0.00
IGL02898:Gm6614 APN 6 141994297 missense probably benign 0.01
IGL03036:Gm6614 APN 6 142008607 missense possibly damaging 0.69
IGL03065:Gm6614 APN 6 141992502 missense probably damaging 0.99
IGL03300:Gm6614 APN 6 141994806 missense probably damaging 0.96
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0149:Gm6614 UTSW 6 141992477 missense probably benign 0.01
R0270:Gm6614 UTSW 6 141972411 missense possibly damaging 0.88
R0360:Gm6614 UTSW 6 141982327 splice site probably benign
R0420:Gm6614 UTSW 6 141985477 splice site probably benign
R0737:Gm6614 UTSW 6 142003428 missense possibly damaging 0.79
R1344:Gm6614 UTSW 6 141985618 missense probably damaging 1.00
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1590:Gm6614 UTSW 6 141980872 missense probably benign 0.00
R1666:Gm6614 UTSW 6 141982049 splice site probably null
R1669:Gm6614 UTSW 6 141987689 missense probably benign 0.39
R1862:Gm6614 UTSW 6 142003423 missense possibly damaging 0.95
R1882:Gm6614 UTSW 6 141993637 critical splice donor site probably null
R2134:Gm6614 UTSW 6 141980978 missense probably damaging 1.00
R2155:Gm6614 UTSW 6 141980944 missense probably damaging 1.00
R2163:Gm6614 UTSW 6 141980938 missense possibly damaging 0.55
R2227:Gm6614 UTSW 6 141992361 missense possibly damaging 0.67
R2382:Gm6614 UTSW 6 141990480 missense probably benign 0.00
R3773:Gm6614 UTSW 6 141972335 missense probably benign 0.17
R4869:Gm6614 UTSW 6 141987766 missense probably damaging 1.00
R4975:Gm6614 UTSW 6 141980873 missense probably benign 0.30
R5061:Gm6614 UTSW 6 142008688 missense probably benign 0.03
R5079:Gm6614 UTSW 6 141972347 missense probably benign 0.00
R5312:Gm6614 UTSW 6 141972332 missense probably benign 0.00
R5691:Gm6614 UTSW 6 141994855 nonsense probably null
R5874:Gm6614 UTSW 6 141972235 missense probably benign 0.00
R5945:Gm6614 UTSW 6 141994282 missense probably damaging 1.00
R6478:Gm6614 UTSW 6 141993642 missense possibly damaging 0.93
R7305:Gm6614 UTSW 6 141992494 missense probably damaging 1.00
R7325:Gm6614 UTSW 6 141989225 missense probably damaging 0.98
R7427:Gm6614 UTSW 6 142003508 critical splice acceptor site probably null
R7728:Gm6614 UTSW 6 141987710 nonsense probably null
R7949:Gm6614 UTSW 6 141994265 missense probably damaging 1.00
R8079:Gm6614 UTSW 6 141987734 missense probably benign 0.00
R8095:Gm6614 UTSW 6 141987689 missense probably benign 0.39
Z1176:Gm6614 UTSW 6 141990348 missense probably benign 0.01
Z1177:Gm6614 UTSW 6 141994202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAATGTCAAGAGTATGTGC -3'
(R):5'- AAAGTTTCTTGGATGTTCAAGGGC -3'

Sequencing Primer
(F):5'- GTGCTACAAATTAGGTGTCATCATG -3'
(R):5'- TTCAAGGGCTATTTATGTTGGATAC -3'
Posted On2019-12-04