Incidental Mutation 'RF021:Ttbk2'
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Nametau tubulin kinase 2
SynonymsB930008N24Rik, 2610507N02Rik, TTK
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosomal Location120732816-120850604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120748634 bp
Amino Acid Change Valine to Alanine at position 669 (V669A)
Ref Sequence ENSEMBL: ENSMUSP00000028740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000131389] [ENSMUST00000143051]
Predicted Effect probably benign
Transcript: ENSMUST00000028740
AA Change: V669A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: V669A

Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057135
AA Change: V600A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: V600A

Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085840
AA Change: V600A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: V600A

Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131389
SMART Domains Protein: ENSMUSP00000118905
Gene: ENSMUSG00000090100

Pfam:Pkinase 21 145 1.3e-18 PFAM
Pfam:Pkinase_Tyr 21 148 9.7e-12 PFAM
Pfam:Pkinase 145 239 1.2e-5 PFAM
low complexity region 265 279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143051
AA Change: V600A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100
AA Change: V600A

Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0279:Ttbk2 UTSW 2 120748960 missense probably benign 0.00
R0362:Ttbk2 UTSW 2 120745783 missense possibly damaging 0.90
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R0906:Ttbk2 UTSW 2 120783781 missense probably damaging 1.00
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 splice site probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4962:Ttbk2 UTSW 2 120745150 missense probably damaging 1.00
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7013:Ttbk2 UTSW 2 120745784 missense possibly damaging 0.89
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
R7475:Ttbk2 UTSW 2 120748640 missense probably benign 0.01
R7891:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
R8529:Ttbk2 UTSW 2 120773857 missense possibly damaging 0.67
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04