Incidental Mutation 'R7887:B4galt1'
ID 609103
Institutional Source Beutler Lab
Gene Symbol B4galt1
Ensembl Gene ENSMUSG00000028413
Gene Name UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms GalT, Ggtb, beta 1,4-Galactosyltransferase I, Ggtb2, beta-1,4-GalT1, b1,4-Galactosyltransferase I, B-1,4-GalT1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7887 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 40804602-40854005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40823501 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 197 (Y197H)
Ref Sequence ENSEMBL: ENSMUSP00000030121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030121] [ENSMUST00000108096]
AlphaFold P15535
Predicted Effect probably benign
Transcript: ENSMUST00000030121
AA Change: Y197H

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030121
Gene: ENSMUSG00000028413
AA Change: Y197H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 264 3.1e-62 PFAM
Pfam:Glyco_transf_7C 268 346 5.9e-32 PFAM
Pfam:Glyco_tranf_2_2 279 339 4.1e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108096
AA Change: Y197H

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103731
Gene: ENSMUSG00000028413
AA Change: Y197H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
Pfam:Glyco_transf_7N 131 266 1.8e-52 PFAM
Pfam:Glyco_transf_7C 268 328 8.7e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes two distinct enzyme isoforms, a long membrane-bound form and a short soluble form. These alternate isoforms are thought to be produced through alternative nested transcription initiation and different in-frame start codon usage. These enzymes catalyze the transfer of galactose to acceptor sugars, such as N-acetylglucosamine and glucose. The long form of this enzyme is localized to the trans-Golgi membrane and is involved in glycoconjugate biosynthesis. The short form functions in lactose biosynthesis though formation of a heterodimer with alpha-lactalbumin. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit growth retardation, low viability, excessive epithelial cell proliferation of skin and small intestine, sperm with reduced fertilizing capacity, birthing difficulty, and mammary gland defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh8 T A 9: 3,385,343 I580N probably damaging Het
Ankrd35 C T 3: 96,684,900 T834M probably damaging Het
Astn2 C T 4: 65,644,866 V893I possibly damaging Het
Brdt T C 5: 107,359,933 S676P possibly damaging Het
Chrdl2 T C 7: 100,029,250 V343A possibly damaging Het
Clcn3 A T 8: 60,941,399 M59K probably benign Het
Cpne4 A T 9: 105,032,791 N529I probably damaging Het
Crcp G T 5: 130,037,870 K32N possibly damaging Het
Ddx54 C T 5: 120,627,203 R846C probably damaging Het
Dennd6a T C 14: 26,599,657 S118P possibly damaging Het
Egr3 A G 14: 70,079,202 Y116C probably damaging Het
Fbxw25 A G 9: 109,649,594 probably null Het
Focad T G 4: 88,182,616 I313M probably damaging Het
Gm10272 C T 10: 77,706,945 P107L probably benign Het
Gpr26 A C 7: 131,966,973 I16L probably benign Het
Gpr39 C A 1: 125,677,542 T69K probably damaging Het
Hacl1 C T 14: 31,634,227 G97S probably damaging Het
Idh3b A C 2: 130,281,758 D136E probably damaging Het
Irf6 G A 1: 193,167,732 V321M probably damaging Het
Klrg2 T A 6: 38,636,571 T166S probably damaging Het
Lnx2 T C 5: 147,019,043 I648V probably damaging Het
Mecr A G 4: 131,860,866 probably null Het
Mnat1 T A 12: 73,188,191 S205T probably benign Het
Mpnd G A 17: 56,011,097 G204D probably benign Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Nid1 G T 13: 13,499,733 R899L possibly damaging Het
Nisch C T 14: 31,176,695 W664* probably null Het
Nudt6 C T 3: 37,412,380 V157I possibly damaging Het
Olfr1156 T C 2: 87,949,880 M118V probably damaging Het
Olfr573-ps1 A C 7: 102,942,151 L142R possibly damaging Het
Olfr949-ps1 A T 9: 39,364,879 M107L unknown Het
Onecut2 T A 18: 64,340,975 M180K possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pclo GTCTAT GTCTATTCTAT 5: 14,714,190 probably null Het
Phf11d A G 14: 59,359,580 Y57H probably damaging Het
Prkaca T C 8: 83,986,895 V99A probably benign Het
Rnf144b T A 13: 47,239,811 C209S probably damaging Het
Scly G A 1: 91,300,641 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sphkap T C 1: 83,277,412 Y872C probably benign Het
Ssh1 C T 5: 113,961,349 probably null Het
Strap T G 6: 137,739,809 L129V possibly damaging Het
Sympk T C 7: 19,034,439 I111T possibly damaging Het
Tprn C A 2: 25,264,012 A442E probably damaging Het
Tsen34 T C 7: 3,694,708 L36P probably damaging Het
Ubr4 T C 4: 139,407,810 F818L probably damaging Het
Uggt1 T C 1: 36,208,034 Y294C probably damaging Het
Usp20 A G 2: 31,020,894 K862E probably benign Het
Vmn1r201 A T 13: 22,474,786 I57F probably damaging Het
Wdr64 C T 1: 175,785,545 A662V not run Het
Other mutations in B4galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:B4galt1 APN 4 40807760 missense probably damaging 1.00
periwinkle UTSW 4 40807760 missense probably damaging 1.00
R1589:B4galt1 UTSW 4 40823575 missense probably benign 0.28
R3797:B4galt1 UTSW 4 40807258 missense probably benign 0.12
R4419:B4galt1 UTSW 4 40853537 missense probably benign
R4703:B4galt1 UTSW 4 40823569 missense probably benign 0.14
R4727:B4galt1 UTSW 4 40807812 missense probably damaging 1.00
R5706:B4galt1 UTSW 4 40807268 missense probably damaging 0.97
R5903:B4galt1 UTSW 4 40807760 missense probably damaging 1.00
R6860:B4galt1 UTSW 4 40807796 missense probably benign 0.00
R6878:B4galt1 UTSW 4 40809694 missense probably damaging 1.00
R6943:B4galt1 UTSW 4 40812860 missense probably benign 0.00
R7239:B4galt1 UTSW 4 40812754 missense probably damaging 1.00
R7479:B4galt1 UTSW 4 40823587 missense probably damaging 1.00
R7792:B4galt1 UTSW 4 40809373 missense probably benign 0.00
R7923:B4galt1 UTSW 4 40809373 missense probably benign 0.00
R8330:B4galt1 UTSW 4 40812787 missense probably damaging 1.00
R8968:B4galt1 UTSW 4 40807243 missense probably benign
R9450:B4galt1 UTSW 4 40853804 start codon destroyed probably null 0.98
R9574:B4galt1 UTSW 4 40853766 missense probably benign
R9705:B4galt1 UTSW 4 40853474 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATACCGCTTGGCACTTAGCTC -3'
(R):5'- CTAGTTGGCCCCATGCTGATTG -3'

Sequencing Primer
(F):5'- CGCTGCACTGTTTAAAGGAC -3'
(R):5'- CCCATGCTGATTGACTTTAATATTGC -3'
Posted On 2019-12-20