Mutagenetix > Incidental Mutation

Incidental Mutation 'R7887:Usp20'

609098

Institutional Source

Beutler Lab

Gene Symbol

Usp20

Ensembl Gene

ENSMUSG00000026854

Gene Name

ubiquitin specific peptidase 20

Synonyms

1700055M05Rik, Vdu2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30982279-31023586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31020894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 862 (K862E)

Ref Sequence

ENSEMBL: ENSMUSP00000099913 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102849] [ENSMUST00000170476]

AlphaFold

Q8C6M1

Predicted Effect

probably benign
Transcript: ENSMUST00000102849
AA Change: K862E

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: K862E

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	95	4.3e-17	PFAM
low complexity region	128	138	N/A	INTRINSIC
Pfam:UCH	144	684	5e-63	PFAM
Pfam:UCH_1	145	669	8.8e-24	PFAM
DUSP	704	787	5.97e-28	SMART
DUSP	812	897	4.74e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170476
AA Change: K862E

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: K862E

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	30	95	3.4e-17	PFAM
low complexity region	128	138	N/A	INTRINSIC
Pfam:UCH	144	270	1.2e-26	PFAM
Pfam:UCH_1	145	669	6.1e-20	PFAM
Pfam:UCH	324	684	1.6e-31	PFAM
DUSP	704	787	5.97e-28	SMART
DUSP	812	897	4.74e-31	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh8	T	A	9: 3,385,343	I580N	probably damaging	Het
Ankrd35	C	T	3: 96,684,900	T834M	probably damaging	Het
Astn2	C	T	4: 65,644,866	V893I	possibly damaging	Het
B4galt1	A	G	4: 40,823,501	Y197H	probably benign	Het
Brdt	T	C	5: 107,359,933	S676P	possibly damaging	Het
Chrdl2	T	C	7: 100,029,250	V343A	possibly damaging	Het
Clcn3	A	T	8: 60,941,399	M59K	probably benign	Het
Cpne4	A	T	9: 105,032,791	N529I	probably damaging	Het
Crcp	G	T	5: 130,037,870	K32N	possibly damaging	Het
Ddx54	C	T	5: 120,627,203	R846C	probably damaging	Het
Dennd6a	T	C	14: 26,599,657	S118P	possibly damaging	Het
Egr3	A	G	14: 70,079,202	Y116C	probably damaging	Het
Fbxw25	A	G	9: 109,649,594		probably null	Het
Focad	T	G	4: 88,182,616	I313M	probably damaging	Het
Gm10272	C	T	10: 77,706,945	P107L	probably benign	Het
Gpr26	A	C	7: 131,966,973	I16L	probably benign	Het
Gpr39	C	A	1: 125,677,542	T69K	probably damaging	Het
Hacl1	C	T	14: 31,634,227	G97S	probably damaging	Het
Idh3b	A	C	2: 130,281,758	D136E	probably damaging	Het
Irf6	G	A	1: 193,167,732	V321M	probably damaging	Het
Klrg2	T	A	6: 38,636,571	T166S	probably damaging	Het
Lnx2	T	C	5: 147,019,043	I648V	probably damaging	Het
Mecr	A	G	4: 131,860,866		probably null	Het
Mnat1	T	A	12: 73,188,191	S205T	probably benign	Het
Mpnd	G	A	17: 56,011,097	G204D	probably benign	Het
Myh7	C	T	14: 54,983,662	E935K	possibly damaging	Het
Nid1	G	T	13: 13,499,733	R899L	possibly damaging	Het
Nisch	C	T	14: 31,176,695	W664*	probably null	Het
Nudt6	C	T	3: 37,412,380	V157I	possibly damaging	Het
Olfr1156	T	C	2: 87,949,880	M118V	probably damaging	Het
Olfr573-ps1	A	C	7: 102,942,151	L142R	possibly damaging	Het
Olfr949-ps1	A	T	9: 39,364,879	M107L	unknown	Het
Onecut2	T	A	18: 64,340,975	M180K	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pclo	GTCTAT	GTCTATTCTAT	5: 14,714,190		probably null	Het
Phf11d	A	G	14: 59,359,580	Y57H	probably damaging	Het
Prkaca	T	C	8: 83,986,895	V99A	probably benign	Het
Rnf144b	T	A	13: 47,239,811	C209S	probably damaging	Het
Scly	G	A	1: 91,300,641		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sphkap	T	C	1: 83,277,412	Y872C	probably benign	Het
Ssh1	C	T	5: 113,961,349		probably null	Het
Strap	T	G	6: 137,739,809	L129V	possibly damaging	Het
Sympk	T	C	7: 19,034,439	I111T	possibly damaging	Het
Tprn	C	A	2: 25,264,012	A442E	probably damaging	Het
Tsen34	T	C	7: 3,694,708	L36P	probably damaging	Het
Ubr4	T	C	4: 139,407,810	F818L	probably damaging	Het
Uggt1	T	C	1: 36,208,034	Y294C	probably damaging	Het
Vmn1r201	A	T	13: 22,474,786	I57F	probably damaging	Het
Wdr64	C	T	1: 175,785,545	A662V	not run	Het

Other mutations in Usp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Usp20	APN	2	31004950	missense	probably damaging	1.00
IGL01444:Usp20	APN	2	30998789	start codon destroyed	probably null	1.00
IGL01601:Usp20	APN	2	31011794	missense	probably benign	0.04
IGL01785:Usp20	APN	2	31017163	missense	probably benign	0.02
IGL01786:Usp20	APN	2	31017163	missense	probably benign	0.02
IGL02129:Usp20	APN	2	31004450	missense	probably benign	0.43
IGL02147:Usp20	APN	2	31006401	missense	probably damaging	1.00
IGL03396:Usp20	APN	2	31011717	missense	probably benign
BB007:Usp20	UTSW	2	31010544	missense	probably benign	0.21
BB017:Usp20	UTSW	2	31010544	missense	probably benign	0.21
PIT4453001:Usp20	UTSW	2	31017486	missense	possibly damaging	0.47
R0111:Usp20	UTSW	2	31002612	missense	probably damaging	1.00
R0369:Usp20	UTSW	2	31011104	missense	probably benign	0.00
R0479:Usp20	UTSW	2	31017475	missense	probably benign	0.18
R0538:Usp20	UTSW	2	31004450	missense	probably damaging	0.99
R1023:Usp20	UTSW	2	31007813	missense	probably damaging	1.00
R1183:Usp20	UTSW	2	31011785	missense	probably benign	0.17
R1635:Usp20	UTSW	2	31018818	missense	probably benign	0.03
R2114:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2115:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2116:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2117:Usp20	UTSW	2	31016305	missense	probably damaging	1.00
R2232:Usp20	UTSW	2	31018738	missense	probably benign	0.13
R2244:Usp20	UTSW	2	31010331	missense	possibly damaging	0.65
R2883:Usp20	UTSW	2	31018800	missense	probably benign
R4734:Usp20	UTSW	2	31019824	missense	probably benign	0.31
R5507:Usp20	UTSW	2	31010226	missense	probably benign
R5770:Usp20	UTSW	2	31017508	missense	probably damaging	1.00
R5862:Usp20	UTSW	2	31006449	nonsense	probably null
R6315:Usp20	UTSW	2	31017758	missense	possibly damaging	0.70
R7603:Usp20	UTSW	2	31011474	missense	probably damaging	1.00
R7930:Usp20	UTSW	2	31010544	missense	probably benign	0.21
R8542:Usp20	UTSW	2	31011624	missense	possibly damaging	0.94
R8965:Usp20	UTSW	2	31011785	missense	possibly damaging	0.77
R9079:Usp20	UTSW	2	31005108	intron	probably benign
R9226:Usp20	UTSW	2	31017400	missense	probably damaging	0.99
R9417:Usp20	UTSW	2	30983018	critical splice acceptor site	probably null
R9459:Usp20	UTSW	2	31011012	missense	probably damaging	0.99
Z1176:Usp20	UTSW	2	31019818	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGAGGAAGGCTTTGGTACAC -3'
(R):5'- ACTAGGCTAGCAGTGGGTAG -3'

Sequencing Primer
(F):5'- GGTACACCAAGTATCCTTTGTTAGC -3'
(R):5'- TGCAGGGCCTGGAGGAC -3'

Posted On

2019-12-20