Incidental Mutation 'R8136:Rab3c'
ID 632272
Institutional Source Beutler Lab
Gene Symbol Rab3c
Ensembl Gene ENSMUSG00000021700
Gene Name RAB3C, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8136 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 110054187-110280996 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 110181020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 110 (Y110*)
Ref Sequence ENSEMBL: ENSMUSP00000132945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167824] [ENSMUST00000223922] [ENSMUST00000224180]
AlphaFold P62823
Predicted Effect probably null
Transcript: ENSMUST00000167824
AA Change: Y110*
SMART Domains Protein: ENSMUSP00000132945
Gene: ENSMUSG00000021700
AA Change: Y110*

DomainStartEndE-ValueType
RAB 31 194 1.35e-93 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223922
AA Change: Y108*
Predicted Effect probably null
Transcript: ENSMUST00000224180
AA Change: Y110*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.7%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,248,397 M2462L probably benign Het
Aptx A G 4: 40,688,107 probably null Het
Bmpr1b A G 3: 141,856,382 I348T probably damaging Het
Btnl1 T A 17: 34,380,040 probably null Het
Col27a1 T A 4: 63,283,953 D960E probably benign Het
Crygn G T 5: 24,751,092 R172S probably benign Het
Cyp26a1 T C 19: 37,701,206 I450T probably benign Het
Emc2 A G 15: 43,511,806 Y233C probably benign Het
Esyt2 C A 12: 116,363,459 T549K probably benign Het
Fam71e1 T C 7: 44,500,280 F142L probably damaging Het
Gatm T C 2: 122,595,537 D411G probably damaging Het
Gpr65 T C 12: 98,275,156 Y23H probably damaging Het
Itpr1 A G 6: 108,438,360 R1752G probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Mcm9 A G 10: 53,611,343 *543Q probably null Het
Mfsd2a A T 4: 122,951,867 C164S probably benign Het
Mta1 C A 12: 113,131,678 R484S probably damaging Het
Nlrp9a T G 7: 26,557,253 F99V probably benign Het
Notch2 G A 3: 98,124,221 C1137Y probably damaging Het
Olfr575 A T 7: 102,955,241 M120K probably damaging Het
Pcnx A G 12: 81,918,006 T316A probably benign Het
Phf11a A G 14: 59,277,569 V221A probably benign Het
Pigb A G 9: 73,022,320 L327P possibly damaging Het
Sdk2 G A 11: 113,851,713 T790M probably damaging Het
Slc22a2 C T 17: 12,606,030 P260S probably damaging Het
Sppl2a T C 2: 126,913,281 probably null Het
Tmem189 A C 2: 167,644,959 Y167D probably benign Het
Tnn T A 1: 160,107,060 Q1261L probably damaging Het
Treml4 C A 17: 48,264,717 Y49* probably null Het
Ttc37 A G 13: 76,113,103 K131R probably benign Het
Ubr3 T C 2: 70,021,179 I1827T probably damaging Het
Vrtn C T 12: 84,650,035 R520C probably damaging Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Wls C A 3: 159,873,124 Q108K probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp39 A T 11: 58,891,402 V178D probably damaging Het
Zfp777 C A 6: 48,044,625 R21L probably benign Het
Other mutations in Rab3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1294:Rab3c UTSW 13 110260565 missense possibly damaging 0.72
R1346:Rab3c UTSW 13 110260586 missense probably damaging 1.00
R1819:Rab3c UTSW 13 110084135 missense possibly damaging 0.52
R1903:Rab3c UTSW 13 110084210 missense probably damaging 1.00
R2059:Rab3c UTSW 13 110260516 missense probably damaging 1.00
R4018:Rab3c UTSW 13 110084194 missense probably damaging 1.00
R4707:Rab3c UTSW 13 110061900 missense probably benign 0.00
R4784:Rab3c UTSW 13 110061900 missense probably benign 0.00
R4785:Rab3c UTSW 13 110061900 missense probably benign 0.00
R5305:Rab3c UTSW 13 110181077 missense probably damaging 1.00
R5358:Rab3c UTSW 13 110061963 missense possibly damaging 0.77
R8739:Rab3c UTSW 13 110260601 missense probably damaging 0.98
Z1177:Rab3c UTSW 13 110260486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTTCCTTGGCTCAGGGC -3'
(R):5'- GGAAGGAAAGACATCTGTACCC -3'

Sequencing Primer
(F):5'- CACAAGTGGGATTGTAGCTCATG -3'
(R):5'- GGAAAGACATCTGTACCCTGTAC -3'
Posted On 2020-06-30