Incidental Mutation 'R8143:Otogl'
ID632649
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8143 (G1)
Quality Score206.009
Status Validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107806666 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1301 (F1301S)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably damaging
Transcript: ENSMUST00000165341
AA Change: F1301S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: F1301S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Meta Mutation Damage Score 0.2859 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 85.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,375,872 C262F probably damaging Het
4932438A13Rik T G 3: 36,946,508 probably null Het
Acss1 T C 2: 150,667,881 probably null Het
Adamtsl1 T C 4: 86,342,255 V909A possibly damaging Het
Adprh G A 16: 38,450,332 T37M probably benign Het
Ak9 T A 10: 41,337,592 Y264* probably null Het
Aox3 G T 1: 58,158,915 A629S probably benign Het
Apcs G A 1: 172,894,333 P149S probably damaging Het
Arnt T A 3: 95,469,983 probably null Het
Asb13 G A 13: 3,642,065 G15D probably damaging Het
Cacnb1 T G 11: 98,003,320 T459P probably benign Het
Chrnb2 T C 3: 89,747,323 T718A unknown Het
Cttn T A 7: 144,461,262 K70* probably null Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp39a1 T C 17: 43,725,626 V349A probably benign Het
Ebf2 C A 14: 67,411,937 Y430* probably null Het
Eef2 T C 10: 81,181,348 Y730H probably damaging Het
Eif2ak2 G A 17: 78,858,532 T412I probably benign Het
Flnc G C 6: 29,441,485 R422P probably benign Het
Fryl G A 5: 73,050,339 A2496V probably benign Het
Galnt6 A G 15: 100,716,207 L71P probably damaging Het
Gm7579 C T 7: 142,212,426 Q190* probably null Het
H2-T3 T A 17: 36,187,492 R220S probably benign Het
Hmcn1 A G 1: 150,859,206 V185A probably benign Het
Ifi208 T A 1: 173,682,676 D132E possibly damaging Het
Itgb4 G A 11: 115,993,429 V981I probably damaging Het
Itsn2 A G 12: 4,633,003 T310A unknown Het
Kat5 A G 19: 5,607,549 probably null Het
Kif22 A T 7: 127,033,225 D304E probably damaging Het
Mapre3 A T 5: 30,863,375 N147Y possibly damaging Het
Morc2a T C 11: 3,678,537 V330A probably benign Het
Mylk G A 16: 34,914,155 V709M possibly damaging Het
Myo3a T G 2: 22,282,665 probably null Het
N4bp2l2 A T 5: 150,662,205 D103E probably benign Het
Nckap1 T C 2: 80,506,186 K1062R possibly damaging Het
Nol9 T C 4: 152,041,102 V170A possibly damaging Het
Numa1 A G 7: 101,999,684 Q874R possibly damaging Het
Olfr854 A G 9: 19,567,291 V31A probably benign Het
Olig3 T G 10: 19,356,984 V119G probably damaging Het
Osbpl9 A G 4: 109,065,709 S485P probably benign Het
Pank3 A G 11: 35,776,209 Y51C probably damaging Het
Pex5l T C 3: 33,082,509 probably benign Het
Pgm2 G A 4: 99,967,218 probably null Het
Psmd9 T G 5: 123,228,416 I37S probably damaging Het
Qtrt2 A G 16: 43,871,754 S135P probably damaging Het
Rexo5 T A 7: 119,834,261 probably null Het
Rsrp1 T A 4: 134,927,008 D286E probably benign Het
Scara3 C T 14: 65,931,820 C116Y probably damaging Het
Serpina3b A T 12: 104,130,534 T25S probably benign Het
Sh3pxd2a G A 19: 47,268,699 P555S probably damaging Het
Slc1a2 T A 2: 102,737,885 L89Q probably damaging Het
Tgm6 T A 2: 130,141,843 N307K probably damaging Het
Tmem86b G T 7: 4,628,485 D189E probably damaging Het
Trim65 G A 11: 116,126,461 R392C probably benign Het
Trpc7 T C 13: 56,782,549 T769A probably benign Het
Trrap T A 5: 144,835,897 probably null Het
Ttn T C 2: 76,863,333 E397G possibly damaging Het
Vcl A T 14: 20,987,044 M237L possibly damaging Het
Vmn1r36 G A 6: 66,716,052 Q280* probably null Het
Vmn2r23 A T 6: 123,741,353 D555V probably damaging Het
Wnk4 A G 11: 101,262,799 N229S probably damaging Het
Zfp784 A C 7: 5,035,911 V216G possibly damaging Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
R7864:Otogl UTSW 10 107869567 missense probably damaging 1.00
R7879:Otogl UTSW 10 107777109 missense probably benign 0.00
R7956:Otogl UTSW 10 107878026 missense possibly damaging 0.62
R7988:Otogl UTSW 10 107895776 missense probably damaging 1.00
R8057:Otogl UTSW 10 107808615 missense probably benign 0.00
R8058:Otogl UTSW 10 107762426 missense probably damaging 1.00
R8127:Otogl UTSW 10 107895752 missense probably damaging 1.00
R8310:Otogl UTSW 10 107777600 missense possibly damaging 0.94
R8319:Otogl UTSW 10 107853266 critical splice donor site probably null
R8339:Otogl UTSW 10 107789535 missense probably damaging 0.99
R8339:Otogl UTSW 10 107789536 missense probably benign 0.34
R8394:Otogl UTSW 10 107886465 critical splice donor site probably null
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Z1176:Otogl UTSW 10 107777213 missense probably benign
Z1176:Otogl UTSW 10 107778873 missense probably damaging 0.97
Z1176:Otogl UTSW 10 107789032 missense probably benign 0.00
Z1177:Otogl UTSW 10 107763258 nonsense probably null
Z1177:Otogl UTSW 10 107853397 missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107876903 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CACGGCCTAAGAATCTGTGC -3'
(R):5'- CTGCATATTATAAGGCCCTTGC -3'

Sequencing Primer
(F):5'- GGCCTAAGAATCTGTGCTCCTC -3'
(R):5'- CCTGTGTTTTGCCTTTCTCTGAGG -3'
Posted On2020-06-30