Incidental Mutation 'R2508:Otogl'
ID251576
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 040414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2508 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107874500 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 576 (L576P)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably damaging
Transcript: ENSMUST00000165341
AA Change: L576P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: L576P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,393 T20I probably benign Het
Adamts2 C T 11: 50,788,689 T832I possibly damaging Het
Agbl1 G A 7: 76,589,550 probably null Het
Ankrd61 T C 5: 143,897,076 probably benign Het
Anpep T G 7: 79,838,291 Y506S possibly damaging Het
Aox2 T A 1: 58,343,673 H1037Q probably benign Het
Auh G A 13: 52,898,719 R47* probably null Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh3 T C 8: 106,552,407 L667P probably damaging Het
Cenpe A T 3: 135,241,073 R1116S possibly damaging Het
Ces1b T A 8: 93,073,341 M136L possibly damaging Het
Cfap54 T C 10: 92,997,374 E1130G possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clu T C 14: 65,975,003 V135A probably damaging Het
Cmip T A 8: 117,436,693 S388T probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Crym T C 7: 120,201,827 N33S probably benign Het
Ctcf T A 8: 105,671,384 V434E probably damaging Het
D430042O09Rik T A 7: 125,795,343 V197D probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dcaf13 A G 15: 39,145,152 Y383C probably benign Het
Dock2 T C 11: 34,312,485 T957A probably benign Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Fads3 A G 19: 10,056,454 Y401C probably damaging Het
Fam72a T C 1: 131,528,854 probably null Het
Fbxw21 C A 9: 109,145,485 K322N probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Glb1l T C 1: 75,201,829 T322A probably damaging Het
Gm6803 T C 12: 88,018,488 Y95C probably damaging Het
Gm6871 T A 7: 41,547,990 T149S probably benign Het
Gpr26 C T 7: 131,967,094 T56I probably damaging Het
Grik4 C A 9: 42,622,142 G361C probably damaging Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Igsf5 T A 16: 96,364,047 D7E probably benign Het
Inpp5e T A 2: 26,399,343 I522F probably damaging Het
Insm2 C A 12: 55,600,311 T280K probably benign Het
Itih4 T C 14: 30,895,478 V585A probably damaging Het
Knl1 A T 2: 119,058,368 R17* probably null Het
Lag3 G T 6: 124,911,309 L15I possibly damaging Het
Lepr T A 4: 101,790,896 S861T probably damaging Het
Mcur1 A T 13: 43,544,465 Y320N probably damaging Het
Mgam A T 6: 40,759,783 D872V probably damaging Het
Mlycd T C 8: 119,407,707 probably null Het
Mpl C A 4: 118,455,757 C193F probably damaging Het
Mycbp2 C A 14: 103,131,245 A4142S probably damaging Het
Myh1 T A 11: 67,213,598 D993E possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Neb T C 2: 52,195,521 I1521V probably benign Het
Notch1 A G 2: 26,465,473 V1744A possibly damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1056 A G 2: 86,356,364 L6P possibly damaging Het
Olfr1181 T C 2: 88,423,456 T190A possibly damaging Het
Olfr798 T A 10: 129,625,915 I49L probably benign Het
P2ry1 C T 3: 61,003,479 T13M probably damaging Het
Pak6 A T 2: 118,694,569 R559* probably null Het
Papd4 A G 13: 93,184,218 L109S probably damaging Het
Parvb A T 15: 84,297,970 M234L probably benign Het
Pcdha11 T C 18: 37,012,854 V666A possibly damaging Het
Pde3b T A 7: 114,526,857 Y775* probably null Het
Pgam5 A G 5: 110,266,003 L98P probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkib T G 10: 57,728,109 D4E probably damaging Het
Plcb1 A T 2: 135,260,508 I202F probably benign Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Prdm1 T A 10: 44,446,807 T249S probably benign Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rassf2 A T 2: 131,998,243 probably null Het
Rnf185 A G 11: 3,418,067 Y204H probably benign Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Scn11a T A 9: 119,765,529 Y1266F probably damaging Het
Senp7 T A 16: 56,151,362 H287Q probably benign Het
Sgsm3 T C 15: 81,003,872 probably null Het
Slc25a11 A T 11: 70,645,832 V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 T175I probably benign Het
Slc26a3 T A 12: 31,470,903 F702Y probably damaging Het
Smco2 T A 6: 146,859,967 L184H probably damaging Het
Ssc4d A T 5: 135,965,607 C90S probably damaging Het
Sspo T C 6: 48,464,364 S1835P probably damaging Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Syngr1 C T 15: 80,111,740 T160M probably damaging Het
Tgfb1i1 A G 7: 128,248,913 probably null Het
Thoc1 T A 18: 9,977,947 V296E probably damaging Het
Timp2 C T 11: 118,310,586 C75Y probably damaging Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tprn G A 2: 25,268,928 E655K possibly damaging Het
Trbv14 A C 6: 41,135,490 I74L probably benign Het
Trbv5 T A 6: 41,062,621 Y53* probably null Het
Trpm5 T C 7: 143,088,919 Q97R possibly damaging Het
Tut1 A G 19: 8,955,567 D88G probably damaging Het
Ucp2 A T 7: 100,498,413 I200F probably benign Het
Unc45a G A 7: 80,338,875 S131L probably benign Het
Uty A T Y: 1,158,182 H573Q probably damaging Het
Vmn1r17 T A 6: 57,360,870 Y121F possibly damaging Het
Vmn1r53 T C 6: 90,223,572 I257V probably benign Het
Vmn2r90 C T 17: 17,733,967 L798F probably damaging Het
Vmn2r94 A T 17: 18,257,474 M225K probably benign Het
Wdr24 A T 17: 25,824,299 I32F possibly damaging Het
Zc3h11a T A 1: 133,624,783 T529S probably benign Het
Zc3h4 A G 7: 16,434,339 H791R unknown Het
Zfp24 A G 18: 24,017,870 L73P probably damaging Het
Zfp616 T C 11: 74,083,295 I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,677,430 probably benign Het
Zim1 CAG CAGAAG 7: 6,677,431 probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
R7864:Otogl UTSW 10 107869567 missense probably damaging 1.00
R7879:Otogl UTSW 10 107777109 missense probably benign 0.00
R7956:Otogl UTSW 10 107878026 missense possibly damaging 0.62
R7988:Otogl UTSW 10 107895776 missense probably damaging 1.00
R8057:Otogl UTSW 10 107808615 missense probably benign 0.00
R8058:Otogl UTSW 10 107762426 missense probably damaging 1.00
R8127:Otogl UTSW 10 107895752 missense probably damaging 1.00
R8143:Otogl UTSW 10 107806666 missense probably damaging 1.00
R8310:Otogl UTSW 10 107777600 missense possibly damaging 0.94
R8319:Otogl UTSW 10 107853266 critical splice donor site probably null
R8339:Otogl UTSW 10 107789535 missense probably damaging 0.99
R8339:Otogl UTSW 10 107789536 missense probably benign 0.34
R8394:Otogl UTSW 10 107886465 critical splice donor site probably null
R8428:Otogl UTSW 10 107798736 missense probably damaging 1.00
R8444:Otogl UTSW 10 107857114 missense probably benign 0.01
R8501:Otogl UTSW 10 107790560 missense probably benign
R8503:Otogl UTSW 10 107892126 missense probably damaging 1.00
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Z1176:Otogl UTSW 10 107777213 missense probably benign
Z1176:Otogl UTSW 10 107778873 missense probably damaging 0.97
Z1176:Otogl UTSW 10 107789032 missense probably benign 0.00
Z1177:Otogl UTSW 10 107763258 nonsense probably null
Z1177:Otogl UTSW 10 107853397 missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107876903 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTCTCCATTAAAGTGACTGCC -3'
(R):5'- TAGTGGCAGCCCATCAGAAG -3'

Sequencing Primer
(F):5'- TTAAAGTGACTGCCATCAAACTC -3'
(R):5'- ACCACTAGGGATAGATTTAGCCTTGG -3'
Posted On2014-12-04