Incidental Mutation 'R7075:Otogl'
ID549170
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107778929 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1954 (T1954K)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably benign
Transcript: ENSMUST00000165341
AA Change: T1954K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: T1954K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTATATGACATGACGCTCCTTGC -3'
(R):5'- GCTCTCTTCCAGTGGGTATC -3'

Sequencing Primer
(F):5'- ATGACGCTCCTTGCCGAAAG -3'
(R):5'- TCCAGTGGGTATCTAAGGATGGACC -3'
Posted On2019-05-15