Mutagenetix > Incidental Mutation

Incidental Mutation 'V1662:Amph'

63496

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.364) question?

Stock #

V1662 () of strain 633

Quality Score

131

Status

Not validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 19139370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 601 (V601M)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

AlphaFold

Q7TQF7

Predicted Effect

probably benign
Transcript: ENSMUST00000003345
AA Change: V597M

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: V597M

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197545

Predicted Effect

probably benign
Transcript: ENSMUST00000200466
AA Change: V601M

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: V601M

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222698

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	C	5: 114,238,708	G1951R	probably damaging	Het
Adamts12	T	A	15: 11,071,808	L146Q	probably benign	Het
Adgra1	T	C	7: 139,852,579	I111T	probably damaging	Het
Arfgef1	T	C	1: 10,173,253	K1024E	probably damaging	Het
Arhgef2	G	A	3: 88,633,329	R154Q	probably damaging	Het
Bank1	T	A	3: 136,054,418	D782V	probably damaging	Het
Bhlha9	G	T	11: 76,673,036	R163L	probably benign	Het
Cacna1h	T	C	17: 25,377,309	N1913D	possibly damaging	Het
Cd7	T	C	11: 121,037,126	I184V	probably benign	Het
Cdk2ap1	T	A	5: 124,348,676	I68F	possibly damaging	Het
Cfap44	C	A	16: 44,449,138	Y1168*	probably null	Het
D6Ertd527e	T	C	6: 87,111,892	S346P	unknown	Het
Daam2	A	G	17: 49,464,601	L839P	possibly damaging	Het
Fam198a	A	G	9: 121,965,025	R82G	probably damaging	Het
Gm7030	A	G	17: 36,128,931	Y104H	probably benign	Het
Golgb1	A	G	16: 36,898,542	H270R	probably benign	Het
Itgav	C	T	2: 83,783,854	R519W	possibly damaging	Het
Lrp1b	A	T	2: 41,122,932	I2001K	probably damaging	Het
Lrrc40	T	A	3: 158,052,789	I277K	probably damaging	Het
Olfr1025-ps1	C	A	2: 85,918,594	T223K	probably benign	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr1373	T	C	11: 52,145,177	M118V	probably damaging	Het
Olfr524	C	T	7: 140,201,958	D271N	possibly damaging	Het
Pyroxd1	G	A	6: 142,358,443	G307S	probably damaging	Het
Rp1	T	A	1: 4,349,560	Y443F	probably damaging	Het
Rpusd4	C	A	9: 35,272,761	S237R	probably benign	Het
Sdk2	A	C	11: 113,834,908	W1172G	probably damaging	Het
Utrn	A	G	10: 12,421,640	Y675H	probably damaging	Het
Vmn1r193	A	G	13: 22,219,075	I249T	possibly damaging	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7100:Amph	UTSW	13	19149841	makesense	probably null
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8165:Amph	UTSW	13	19094837	missense	probably benign	0.05
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
R9021:Amph	UTSW	13	19099901	missense	probably benign	0.35
R9241:Amph	UTSW	13	19094802	missense	probably damaging	1.00
R9469:Amph	UTSW	13	19086599	missense	probably damaging	1.00
R9717:Amph	UTSW	13	19125083	missense	probably benign	0.07
R9755:Amph	UTSW	13	19113155	missense	probably damaging	1.00
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGTTGTCATTGAGCCAGCCTCC -3'
(R):5'- ACACGGGCTTCGGGTCATTTTC -3'

Sequencing Primer
(F):5'- CCTCCAACCATGAAGGAGAAGG -3'
(R):5'- CCTTGTAGAGAAAGCCAGGAGG -3'

Posted On

2013-07-30