Mutagenetix > Incidental Mutation

Incidental Mutation 'R8402:Galnt7'

652235

Institutional Source

Beutler Lab

Gene Symbol

Galnt7

Ensembl Gene

ENSMUSG00000031608

Gene Name

polypeptide N-acetylgalactosaminyltransferase 7

Synonyms

ppGaNTase-T7

MMRRC Submission

067878-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.719) question?

Stock #

R8402 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57523828-57653032 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 57542919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 355 (A355V)

Ref Sequence

ENSEMBL: ENSMUSP00000105945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]

AlphaFold

Q80VA0

Predicted Effect

probably benign
Transcript: ENSMUST00000034021

SMART Domains

Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	3e-28	PFAM
Pfam:Glyco_tranf_2_2	210	490	2e-7	PFAM
Pfam:Glyco_transf_7C	375	445	1.8e-8	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110316
AA Change: A355V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: A355V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	8.2e-27	PFAM
Pfam:Glyco_tranf_2_2	210	490	1.3e-7	PFAM
Pfam:Glyco_transf_7C	369	445	9.3e-9	PFAM
RICIN	531	652	3.39e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	A	6: 129,323,044	D157V	possibly damaging	Het
Adamts12	A	T	15: 11,263,290	K579N	probably damaging	Het
Adcy7	T	C	8: 88,308,735	V89A	probably benign	Het
Anapc1	G	A	2: 128,630,228	S1458L	probably benign	Het
AW551984	T	C	9: 39,597,653	Y325C	probably damaging	Het
Btnl4	T	C	17: 34,469,493	Y437C	probably damaging	Het
Ccdc88a	T	A	11: 29,463,879	S806T	probably damaging	Het
Ddit4l	A	G	3: 137,626,127	T85A	probably damaging	Het
Dmxl1	G	A	18: 49,878,326	W1183*	probably null	Het
Dmxl1	G	C	18: 49,878,327	D1184H	probably benign	Het
Dmxl1	G	T	18: 49,878,342	V1189L	probably benign	Het
Evpl	T	C	11: 116,225,371	D820G	probably benign	Het
Fam76b	T	C	9: 13,839,676	S289P	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Gabrb2	T	C	11: 42,487,304	W116R	probably damaging	Het
Klk1b5	T	G	7: 44,218,538	F45V	probably benign	Het
Nav2	T	C	7: 49,453,437	V661A	probably benign	Het
Nfkbiz	T	C	16: 55,816,387	N517S	probably damaging	Het
Olfr1330	A	G	4: 118,893,519	I145M	probably benign	Het
Olfr975	T	A	9: 39,950,417	Y118F	probably benign	Het
P2rx1	T	C	11: 73,013,889	F368L	probably damaging	Het
Palld	A	T	8: 61,711,406	V417E	probably damaging	Het
Robo1	C	A	16: 73,024,497	A1375E	probably benign	Het
Rps24	G	T	14: 24,490,761		probably benign	Het
Serpind1	A	G	16: 17,337,085	N259D	probably benign	Het
Sh3bp4	C	A	1: 89,145,315	N628K	probably benign	Het
Tada3	A	T	6: 113,374,813	L177Q	probably damaging	Het
Tcam1	T	A	11: 106,286,905	L508Q	probably damaging	Het
Thbs1	T	C	2: 118,115,878	S360P	possibly damaging	Het
Tmem33	T	C	5: 67,267,375		probably benign	Het
Vmn2r3	A	G	3: 64,271,196		probably benign	Het
Vwa3b	A	G	1: 37,165,798	E121G	probably damaging	Het
Zfp607b	T	A	7: 27,702,702	H194Q	probably damaging	Het
Zfp729b	G	A	13: 67,592,577	P523L	probably damaging	Het

Other mutations in Galnt7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Galnt7	APN	8	57540039	missense	probably damaging	1.00
IGL00538:Galnt7	APN	8	57552522	missense	possibly damaging	0.95
IGL00826:Galnt7	APN	8	57540071	nonsense	probably null
IGL00951:Galnt7	APN	8	57583824	missense	probably damaging	0.96
IGL01662:Galnt7	APN	8	57531735	splice site	probably benign
IGL02280:Galnt7	APN	8	57536790	missense	probably damaging	1.00
IGL02832:Galnt7	APN	8	57552497	missense	probably damaging	1.00
IGL02936:Galnt7	APN	8	57584214	missense	probably benign
IGL03083:Galnt7	APN	8	57526189	missense	probably damaging	0.98
IGL03387:Galnt7	APN	8	57526178	missense	probably benign	0.01
R0400:Galnt7	UTSW	8	57583989	missense	probably damaging	0.99
R0553:Galnt7	UTSW	8	57552430	splice site	probably benign
R1463:Galnt7	UTSW	8	57652858	missense	probably benign
R1487:Galnt7	UTSW	8	57540039	missense	probably damaging	1.00
R1791:Galnt7	UTSW	8	57542530	missense	probably benign	0.05
R1817:Galnt7	UTSW	8	57538178	missense	probably damaging	1.00
R1962:Galnt7	UTSW	8	57532714	missense	probably benign	0.13
R3855:Galnt7	UTSW	8	57532624	splice site	probably benign
R3856:Galnt7	UTSW	8	57532624	splice site	probably benign
R4232:Galnt7	UTSW	8	57652966	missense	probably benign
R4396:Galnt7	UTSW	8	57538181	missense	probably damaging	1.00
R4426:Galnt7	UTSW	8	57552572	nonsense	probably null
R4610:Galnt7	UTSW	8	57545769	missense	probably damaging	0.99
R4745:Galnt7	UTSW	8	57542727	intron	probably benign
R4794:Galnt7	UTSW	8	57545363	missense	probably damaging	1.00
R5014:Galnt7	UTSW	8	57545380	missense	probably damaging	1.00
R5177:Galnt7	UTSW	8	57584027	missense	possibly damaging	0.87
R5682:Galnt7	UTSW	8	57583933	nonsense	probably null
R6122:Galnt7	UTSW	8	57526166	missense	probably damaging	0.99
R6276:Galnt7	UTSW	8	57536578	splice site	probably null
R6684:Galnt7	UTSW	8	57538109	missense	probably benign	0.16
R6752:Galnt7	UTSW	8	57652951	missense	probably damaging	1.00
R7464:Galnt7	UTSW	8	57584020	missense	possibly damaging	0.95
R7491:Galnt7	UTSW	8	57552518	missense	probably damaging	0.97
R7547:Galnt7	UTSW	8	57583962	missense	possibly damaging	0.48
R8093:Galnt7	UTSW	8	57532705	missense	probably benign	0.00
R8221:Galnt7	UTSW	8	57552566	missense	possibly damaging	0.93
R8248:Galnt7	UTSW	8	57538188	missense	probably benign	0.34
R8779:Galnt7	UTSW	8	57584211	missense	probably benign
R8894:Galnt7	UTSW	8	57526142	nonsense	probably null
R8974:Galnt7	UTSW	8	57652900	missense
R9106:Galnt7	UTSW	8	57532695	missense	probably damaging	1.00
R9297:Galnt7	UTSW	8	57542521	missense	probably damaging	0.98
X0050:Galnt7	UTSW	8	57552444	frame shift	probably null
X0062:Galnt7	UTSW	8	57583908	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGGAAACATGTATGGACCCAC -3'
(R):5'- GTTTTCCTAATACAGAGTGCGACC -3'

Sequencing Primer
(F):5'- CCACATAGTTACACGAGTTCATAGGG -3'
(R):5'- TTCCTAATACAGAGTGCGACCAAGAC -3'

Posted On

2020-10-20