Incidental Mutation 'R8472:Mmrn1'
ID 657066
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Name multimerin 1
Synonyms 4921530G03Rik, Emilin4
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8472 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 60924976-60989378 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 60988396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1136 (S1136N)
Ref Sequence ENSEMBL: ENSMUSP00000145156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000129603
AA Change: S1137N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: S1137N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204333
AA Change: S1136N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: S1136N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,641 H21Q possibly damaging Het
Ccdc7a A G 8: 129,027,657 S152P probably damaging Het
Ccnj T C 19: 40,845,164 S222P probably damaging Het
Cdcp2 C T 4: 107,102,784 A132V probably damaging Het
Cnksr3 G T 10: 7,134,532 P71Q probably damaging Het
Col9a3 C T 2: 180,605,264 P185L probably damaging Het
Cpm T C 10: 117,679,978 V319A probably damaging Het
Ctxn2 A G 2: 125,147,608 I52V possibly damaging Het
Cyp2c66 A T 19: 39,176,577 H334L probably benign Het
Dab1 A G 4: 104,479,242 K12E possibly damaging Het
Emsy T C 7: 98,654,830 probably benign Het
Etv4 G T 11: 101,784,001 D56E probably damaging Het
Exoc3l2 C T 7: 19,481,265 R484* probably null Het
Extl1 A G 4: 134,371,292 C143R probably benign Het
Fat3 T C 9: 16,375,267 I987V possibly damaging Het
Fbn1 A C 2: 125,309,802 C2511G probably damaging Het
Fer T A 17: 63,973,149 S72T probably benign Het
Gdf2 A G 14: 33,944,840 D173G probably damaging Het
Gm11639 A T 11: 104,818,637 D1815V probably benign Het
Gm6614 T G 6: 142,003,389 H87P probably damaging Het
Grhl3 T C 4: 135,556,865 E222G probably benign Het
Gria1 A T 11: 57,327,584 M819L probably benign Het
Gsap A T 5: 21,222,434 R187* probably null Het
Heatr6 A G 11: 83,765,853 N314D probably benign Het
Hspd1 T C 1: 55,078,346 D555G probably benign Het
Ighv3-4 T C 12: 114,254,029 Y8C probably benign Het
Lcmt2 A G 2: 121,140,248 V118A probably damaging Het
Lmf2 T C 15: 89,354,802 E37G possibly damaging Het
Macf1 A G 4: 123,453,002 L1161P probably damaging Het
Mbip T A 12: 56,330,269 probably null Het
Mgam A T 6: 40,694,526 probably null Het
Mms22l T C 4: 24,502,943 V73A possibly damaging Het
Mtbp C T 15: 55,586,352 L24F probably damaging Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 A G 14: 69,192,058 N175S probably damaging Het
Nlrp4f A G 13: 65,194,331 I500T possibly damaging Het
Olfr397 C T 11: 73,965,397 S263L possibly damaging Het
Olfr518 T A 7: 108,880,766 Q280L possibly damaging Het
Olfr820 A G 10: 130,017,576 T72A probably damaging Het
Pcdha2 A G 18: 36,941,272 D652G probably damaging Het
Pde6a T A 18: 61,220,946 N114K probably damaging Het
Pdp2 A G 8: 104,594,281 E254G probably benign Het
Pip5kl1 T C 2: 32,580,006 V241A probably benign Het
Prkdc T A 16: 15,651,536 D168E probably damaging Het
Psg27 A T 7: 18,562,090 H143Q probably benign Het
Serpina16 T A 12: 103,672,537 I264F probably benign Het
Slc25a41 G A 17: 57,041,582 H4Y probably benign Het
Smc3 T G 19: 53,628,711 H518Q probably benign Het
Snrpb G T 2: 130,173,122 T158K probably damaging Het
Sobp A G 10: 43,022,396 F398L probably damaging Het
Spidr T A 16: 16,140,727 Q57L probably benign Het
Srd5a3 T G 5: 76,149,801 V26G possibly damaging Het
Stx17 A G 4: 48,166,972 T131A probably benign Het
Susd1 A G 4: 59,332,985 L553P possibly damaging Het
Tbc1d30 C A 10: 121,351,104 G59C probably benign Het
Tekt1 T C 11: 72,352,024 D219G possibly damaging Het
Trav9d-1 A T 14: 52,792,706 D89V possibly damaging Het
Trim34b T C 7: 104,331,338 I211T probably benign Het
Vmn1r25 A T 6: 57,978,546 L253M possibly damaging Het
Vmn1r56 C T 7: 5,195,905 V238M probably damaging Het
Wipf3 A G 6: 54,489,085 I443V probably benign Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7832:Mmrn1 UTSW 6 60987060 splice site probably null
R7979:Mmrn1 UTSW 6 60975977 missense probably damaging 0.96
R8071:Mmrn1 UTSW 6 60944524 start gained probably benign
R8130:Mmrn1 UTSW 6 60960723 missense probably damaging 1.00
R8277:Mmrn1 UTSW 6 60977236 missense probably benign 0.19
R8353:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8453:Mmrn1 UTSW 6 60988377 missense probably damaging 1.00
R8758:Mmrn1 UTSW 6 60987209 missense possibly damaging 0.54
R8803:Mmrn1 UTSW 6 60988287 missense probably damaging 1.00
R8879:Mmrn1 UTSW 6 60976529 missense probably damaging 0.99
R8907:Mmrn1 UTSW 6 60976093 missense probably damaging 1.00
R8983:Mmrn1 UTSW 6 60976058 missense probably benign 0.04
R9200:Mmrn1 UTSW 6 60976876 missense probably damaging 1.00
R9287:Mmrn1 UTSW 6 60975955 missense probably damaging 1.00
R9387:Mmrn1 UTSW 6 60958192 nonsense probably null
R9612:Mmrn1 UTSW 6 60976424 missense probably damaging 0.96
R9674:Mmrn1 UTSW 6 60971088 nonsense probably null
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACAGATATGCTCCGATGGTGG -3'
(R):5'- GGTGCGATATAACAAGTAACCACTG -3'

Sequencing Primer
(F):5'- GGTGGCGTTTTTCGTATCTCACAC -3'
(R):5'- CACTGAACGTGGTCACAGG -3'
Posted On 2021-01-18