Mutagenetix > Incidental Mutation

Incidental Mutation 'R8472:Mgam'

668181

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R8472 (G1)

Quality Score

54.0072

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

splice site (7916 bp from exon)

DNA Base Change (assembly)

A to T at 40694526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202966]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000071535

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000201148

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202966

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	T	A	7: 12,512,641	H21Q	possibly damaging	Het
Ccdc7a	A	G	8: 129,027,657	S152P	probably damaging	Het
Ccnj	T	C	19: 40,845,164	S222P	probably damaging	Het
Cdcp2	C	T	4: 107,102,784	A132V	probably damaging	Het
Cnksr3	G	T	10: 7,134,532	P71Q	probably damaging	Het
Col9a3	C	T	2: 180,605,264	P185L	probably damaging	Het
Cpm	T	C	10: 117,679,978	V319A	probably damaging	Het
Ctxn2	A	G	2: 125,147,608	I52V	possibly damaging	Het
Cyp2c66	A	T	19: 39,176,577	H334L	probably benign	Het
Dab1	A	G	4: 104,479,242	K12E	possibly damaging	Het
Emsy	T	C	7: 98,654,830		probably benign	Het
Etv4	G	T	11: 101,784,001	D56E	probably damaging	Het
Exoc3l2	C	T	7: 19,481,265	R484*	probably null	Het
Extl1	A	G	4: 134,371,292	C143R	probably benign	Het
Fat3	T	C	9: 16,375,267	I987V	possibly damaging	Het
Fbn1	A	C	2: 125,309,802	C2511G	probably damaging	Het
Fer	T	A	17: 63,973,149	S72T	probably benign	Het
Gdf2	A	G	14: 33,944,840	D173G	probably damaging	Het
Gm11639	A	T	11: 104,818,637	D1815V	probably benign	Het
Gm6614	T	G	6: 142,003,389	H87P	probably damaging	Het
Grhl3	T	C	4: 135,556,865	E222G	probably benign	Het
Gria1	A	T	11: 57,327,584	M819L	probably benign	Het
Gsap	A	T	5: 21,222,434	R187*	probably null	Het
Heatr6	A	G	11: 83,765,853	N314D	probably benign	Het
Hspd1	T	C	1: 55,078,346	D555G	probably benign	Het
Ighv3-4	T	C	12: 114,254,029	Y8C	probably benign	Het
Lcmt2	A	G	2: 121,140,248	V118A	probably damaging	Het
Lmf2	T	C	15: 89,354,802	E37G	possibly damaging	Het
Macf1	A	G	4: 123,453,002	L1161P	probably damaging	Het
Mbip	T	A	12: 56,330,269		probably null	Het
Mmrn1	G	A	6: 60,988,396	S1136N	probably damaging	Het
Mms22l	T	C	4: 24,502,943	V73A	possibly damaging	Het
Mtbp	C	T	15: 55,586,352	L24F	probably damaging	Het
Ncr1	T	A	7: 4,338,121	I37N	probably benign	Het
Nkx3-1	A	G	14: 69,192,058	N175S	probably damaging	Het
Nlrp4f	A	G	13: 65,194,331	I500T	possibly damaging	Het
Olfr397	C	T	11: 73,965,397	S263L	possibly damaging	Het
Olfr518	T	A	7: 108,880,766	Q280L	possibly damaging	Het
Olfr820	A	G	10: 130,017,576	T72A	probably damaging	Het
Pcdha2	A	G	18: 36,941,272	D652G	probably damaging	Het
Pde6a	T	A	18: 61,220,946	N114K	probably damaging	Het
Pdp2	A	G	8: 104,594,281	E254G	probably benign	Het
Pip5kl1	T	C	2: 32,580,006	V241A	probably benign	Het
Prkdc	T	A	16: 15,651,536	D168E	probably damaging	Het
Psg27	A	T	7: 18,562,090	H143Q	probably benign	Het
Serpina16	T	A	12: 103,672,537	I264F	probably benign	Het
Slc25a41	G	A	17: 57,041,582	H4Y	probably benign	Het
Smc3	T	G	19: 53,628,711	H518Q	probably benign	Het
Snrpb	G	T	2: 130,173,122	T158K	probably damaging	Het
Sobp	A	G	10: 43,022,396	F398L	probably damaging	Het
Spidr	T	A	16: 16,140,727	Q57L	probably benign	Het
Srd5a3	T	G	5: 76,149,801	V26G	possibly damaging	Het
Stx17	A	G	4: 48,166,972	T131A	probably benign	Het
Susd1	A	G	4: 59,332,985	L553P	possibly damaging	Het
Tbc1d30	C	A	10: 121,351,104	G59C	probably benign	Het
Tekt1	T	C	11: 72,352,024	D219G	possibly damaging	Het
Trav9d-1	A	T	14: 52,792,706	D89V	possibly damaging	Het
Trim34b	T	C	7: 104,331,338	I211T	probably benign	Het
Vmn1r25	A	T	6: 57,978,546	L253M	possibly damaging	Het
Vmn1r56	C	T	7: 5,195,905	V238M	probably damaging	Het
Wipf3	A	G	6: 54,489,085	I443V	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8758:Mgam	UTSW	6	40729043	missense	probably benign	0.41
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8783:Mgam	UTSW	6	40656489	missense	probably damaging	0.99
R8939:Mgam	UTSW	6	40763203	critical splice donor site	probably null
R8968:Mgam	UTSW	6	40757811	critical splice acceptor site	probably null
R8987:Mgam	UTSW	6	40729636	missense	probably damaging	1.00
R9055:Mgam	UTSW	6	40714729	intron	probably benign
R9171:Mgam	UTSW	6	40768212	missense	possibly damaging	0.76
R9252:Mgam	UTSW	6	40729643	missense	probably damaging	0.99
R9258:Mgam	UTSW	6	40680187	missense	probably benign
R9262:Mgam	UTSW	6	40746488	critical splice donor site	probably null
R9287:Mgam	UTSW	6	40728971	intron	probably benign
R9521:Mgam	UTSW	6	40745184	missense	probably damaging	1.00
R9589:Mgam	UTSW	6	40750585	missense	probably damaging	1.00
R9658:Mgam	UTSW	6	40744377	missense	possibly damaging	0.93
R9784:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACATGGTGTTGAAGCTAG -3'
(R):5'- CAGTGACATTTCTGGCATTCTG -3'

Sequencing Primer
(F):5'- CTGCATCTTTTTGAGCCTGAG -3'
(R):5'- ACCACTATACACTGGGAAGG -3'

Posted On

2021-03-19