Mutagenetix > Incidental Mutation

Incidental Mutation 'R7388:Mmrn1'

573254

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7388 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 60976252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 506 (S506T)

Ref Sequence

ENSEMBL: ENSMUSP00000119609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000129603
AA Change: S506T

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: S506T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204333
AA Change: S506T

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: S506T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013F07Rik	T	C	3: 108,543,499	F86L	possibly damaging	Het
Afg3l2	T	C	18: 67,422,953	E436G	probably damaging	Het
Agbl5	T	A	5: 30,903,239	L759*	probably null	Het
Ankrd13b	T	C	11: 77,472,757	D460G	probably benign	Het
Apol10a	A	G	15: 77,489,025	D287G	possibly damaging	Het
Arhgap44	A	T	11: 65,024,268	Y391*	probably null	Het
Asz1	G	T	6: 18,074,901	S271R	probably benign	Het
AW554918	A	G	18: 25,340,113	N325D	probably benign	Het
Brinp2	A	T	1: 158,255,009	L247Q	probably damaging	Het
Casz1	A	G	4: 148,952,393	D1704G	unknown	Het
Cdk5rap1	G	A	2: 154,360,675	R212W	probably damaging	Het
Cdkl2	T	A	5: 92,019,459	T444S	probably benign	Het
Cers2	T	G	3: 95,321,345	F160V	probably benign	Het
Cga	T	A	4: 34,907,076	M99K	probably benign	Het
Cspp1	C	T	1: 10,065,347	R138*	probably null	Het
Dao	T	G	5: 114,015,212	*133E	probably null	Het
Ddx1	A	T	12: 13,225,455	C544S	probably null	Het
Dgkq	A	T	5: 108,658,246	V98E	probably damaging	Het
Dnah6	T	A	6: 73,192,317	T434S	possibly damaging	Het
Dntt	A	G	19: 41,038,979	N162D	probably benign	Het
Dpysl5	T	C	5: 30,745,461	V79A	probably benign	Het
E130309D02Rik	G	A	5: 143,311,845	A149V	probably benign	Het
Ep300	T	C	15: 81,648,366	C1602R	unknown	Het
Flrt3	C	T	2: 140,661,752		probably null	Het
Gk2	A	G	5: 97,456,898	V27A	probably damaging	Het
Gm11639	T	C	11: 104,721,045	L571P	probably damaging	Het
Gnpat	T	G	8: 124,887,814	M663R	probably benign	Het
Hc	A	T	2: 34,984,847		probably null	Het
Il12rb1	A	G	8: 70,810,627	Y67C	probably damaging	Het
Kmt2b	C	T	7: 30,581,960	D1229N	probably damaging	Het
Lamc1	T	C	1: 153,249,076	T650A	probably damaging	Het
Lrp1	G	A	10: 127,583,897	R948*	probably null	Het
Map3k21	T	C	8: 125,927,597	I385T	probably damaging	Het
Nlrp1a	A	G	11: 71,123,197	F409S	probably damaging	Het
Nlrp3	T	A	11: 59,565,066	I896N	probably benign	Het
Noxred1	C	A	12: 87,227,025	V81L	probably damaging	Het
Nrcam	A	T	12: 44,598,489	I1225F	probably damaging	Het
Olfr30	C	T	11: 58,455,655	C98Y	probably damaging	Het
Otos	T	A	1: 92,644,519		probably null	Het
Pcdh20	A	G	14: 88,468,667	I399T	probably benign	Het
Pkhd1	C	T	1: 20,239,304	V2807I	not run	Het
Prrx2	A	G	2: 30,880,890	E235G	probably damaging	Het
Rab13	T	C	3: 90,221,020	I41T	probably damaging	Het
Rai1	A	C	11: 60,189,375	T1422P	possibly damaging	Het
Rcn1	C	T	2: 105,391,991	V217M	probably damaging	Het
Scn2a	T	A	2: 65,688,654	V408E	probably damaging	Het
Sec16a	C	T	2: 26,428,364	A121T		Het
Slc35d1	A	G	4: 103,189,785		probably null	Het
Slc39a6	A	T	18: 24,584,049	V642E	probably damaging	Het
Slc6a19	G	A	13: 73,693,084	A69V	probably benign	Het
Spink6	A	T	18: 44,082,319	T79S	probably damaging	Het
Spire1	T	C	18: 67,519,880	D170G	probably damaging	Het
Sugp1	T	C	8: 70,052,619	S79P	probably damaging	Het
Syne3	A	G	12: 104,967,908	Y201H	probably damaging	Het
Tbc1d10a	T	C	11: 4,205,858		probably null	Het
Tmem14a	C	T	1: 21,229,511	Q122*	probably null	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Trmt61a	A	G	12: 111,678,887	I86V	possibly damaging	Het
Tubgcp4	G	A	2: 121,189,966		probably null	Het
Vmn1r79	T	A	7: 12,176,741	Y183*	probably null	Het
Vmn2r11	A	T	5: 109,054,876	W112R	probably benign	Het
Vpreb1	T	C	16: 16,868,652	K125E	probably benign	Het
Wdr6	A	T	9: 108,574,772	F637L	probably damaging	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AAGAAAATCAGCCCACGTGG -3'
(R):5'- AAGGATGGTAAGGTTGCTGATC -3'

Sequencing Primer
(F):5'- AGCCCACGTGGAAGGACATC -3'
(R):5'- ATCTTGCTCTCTTGGACATGCAAATC -3'

Posted On

2019-09-13