Incidental Mutation 'R8532:Abcb11'
ID659090
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R8532 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69259691 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 950 (V950L)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102709
AA Change: V950L

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: V950L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102710
AA Change: V950L

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: V950L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180142
AA Change: V950L

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: V950L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 T A 11: 54,327,175 V238E probably damaging Het
Adam2 C A 14: 66,056,521 A286S probably damaging Het
Ankrd17 A T 5: 90,264,820 I1215N probably damaging Het
Anxa2 T C 9: 69,467,312 Y24H probably benign Het
Brms1l T C 12: 55,844,479 L106P probably damaging Het
Cacna1e A T 1: 154,465,764 L1166Q probably damaging Het
Ccdc110 T C 8: 45,942,995 L641P probably damaging Het
Cep78 T A 19: 15,959,584 D586V possibly damaging Het
Chek1 T C 9: 36,719,692 D142G probably benign Het
Dennd1b A G 1: 139,170,174 probably benign Het
Eif2b5 T C 16: 20,505,206 V433A probably damaging Het
Enpep A T 3: 129,276,653 Y868* probably null Het
Fam149a T A 8: 45,348,954 T414S possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm3604 A T 13: 62,368,955 C530S possibly damaging Het
Gtf2e2 T C 8: 33,758,605 F140S probably damaging Het
Ighv1-63 T C 12: 115,495,650 D109G probably damaging Het
Igkv3-9 G C 6: 70,588,722 V102L possibly damaging Het
Kif12 G A 4: 63,169,419 Q276* probably null Het
Lrba C T 3: 86,757,483 R557C probably damaging Het
Matn2 C A 15: 34,316,553 Q14K probably benign Het
Mical2 C A 7: 112,318,544 F369L probably damaging Het
Olfr1158 A G 2: 87,990,569 T153A probably damaging Het
Olfr45 T C 7: 140,691,799 V298A probably damaging Het
Olfr675 T C 7: 105,024,566 Y138C probably damaging Het
Pramel1 A G 4: 143,398,555 T350A probably benign Het
Rcbtb1 T A 14: 59,210,524 C72* probably null Het
Ros1 T G 10: 52,098,756 T1578P possibly damaging Het
Rps6kb2 A T 19: 4,159,244 I200N probably damaging Het
Slc17a4 C A 13: 23,904,735 W223L probably damaging Het
Slitrk5 A T 14: 111,679,477 M178L probably benign Het
Snrpa A G 7: 27,191,602 probably null Het
Syt10 C T 15: 89,792,686 E366K probably damaging Het
Tbc1d16 A G 11: 119,155,167 F484L probably benign Het
Tbc1d30 A T 10: 121,267,430 W566R probably damaging Het
Tcaf1 A T 6: 42,678,131 I551K probably damaging Het
Tdrd7 A G 4: 46,016,920 T654A probably damaging Het
Timm44 A T 8: 4,260,549 I401N possibly damaging Het
Xcl1 T A 1: 164,931,946 T62S probably damaging Het
Zbtb11 A T 16: 55,990,889 H470L probably benign Het
Zfp57 A G 17: 37,009,901 T213A possibly damaging Het
Zfp715 A C 7: 43,299,405 I377S possibly damaging Het
Zfp715 A T 7: 43,299,710 D275E probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7937:Abcb11 UTSW 2 69323873 small deletion probably benign
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69274039 missense probably benign 0.09
R8279:Abcb11 UTSW 2 69239205 missense probably benign 0.05
R8426:Abcb11 UTSW 2 69325262 missense probably benign
R8441:Abcb11 UTSW 2 69257230 missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69324037 missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69274155 missense probably benign
R8534:Abcb11 UTSW 2 69323846 missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69265512 missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69257410 intron probably benign
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTCACCTGAAAACATAGCTG -3'
(R):5'- AGTGACAGATAACCCATGGTC -3'

Sequencing Primer
(F):5'- TCACCTGAAAACATAGCTGAAGTTC -3'
(R):5'- ACAGATAACCCATGGTCTGGTTG -3'
Posted On2021-01-18