Incidental Mutation 'R8127:Trip12'
ID 631791
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Name thyroid hormone receptor interactor 12
Synonyms 6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8127 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 84721189-84840516 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84738742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1602 (N1602S)
Ref Sequence ENSEMBL: ENSMUSP00000027421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670]
AlphaFold G5E870
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: N1602S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: N1602S

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: N1602S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: N1602S

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: N1569S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: N1569S

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189670
AA Change: N407S

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: N407S

DomainStartEndE-ValueType
low complexity region 138 149 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
Blast:HECTc 168 222 5e-8 BLAST
Blast:HECTc 378 434 1e-24 BLAST
HECTc 441 830 6.2e-180 SMART
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,043,439 M66T possibly damaging Het
Acvr1 A T 2: 58,477,626 N174K probably benign Het
Ago1 A T 4: 126,454,421 C342S possibly damaging Het
Anapc1 A G 2: 128,632,627 S1423P probably damaging Het
Antxr2 A T 5: 97,980,017 C218* probably null Het
Arsa A G 15: 89,474,864 Y200H probably damaging Het
Atad3a C T 4: 155,753,939 R207Q probably damaging Het
Carmil3 A G 14: 55,498,244 D551G probably damaging Het
Cdk9 A G 2: 32,707,997 I349T probably benign Het
Cmya5 A T 13: 93,094,614 V1322E probably damaging Het
Col4a3 T A 1: 82,649,760 I95K unknown Het
Dab2ip T C 2: 35,644,126 probably benign Het
Dok7 A G 5: 35,087,001 S530G probably benign Het
Dst C T 1: 34,178,229 T1250M probably damaging Het
Dzank1 A C 2: 144,488,816 W439G probably damaging Het
Evx1 T A 6: 52,313,917 S25T possibly damaging Het
Fut10 G A 8: 31,194,971 probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Hyal5 C A 6: 24,891,488 R434S probably benign Het
Lrrc43 C T 5: 123,492,271 P66S probably damaging Het
Mib1 T A 18: 10,741,031 I93N probably damaging Het
Mug2 G A 6: 122,075,608 E1038K probably benign Het
Nsd2 T A 5: 33,885,490 C1033S probably damaging Het
Olfr424 C T 1: 174,137,589 P282S probably damaging Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Otogl A T 10: 107,895,752 F176Y probably damaging Het
Pih1d3 T C 1: 31,223,120 F61S probably benign Het
Polr3b A G 10: 84,679,789 K609E probably benign Het
Prdm15 T C 16: 97,837,710 N50S probably benign Het
Rlf G T 4: 121,147,896 Q1406K possibly damaging Het
Rusc2 T C 4: 43,423,747 V1023A possibly damaging Het
Scn11a C T 9: 119,804,512 G385D probably damaging Het
Slc44a1 T C 4: 53,528,714 S155P probably benign Het
Spam1 T A 6: 24,796,971 V307D possibly damaging Het
Srgap1 A C 10: 121,855,366 M321R probably null Het
Stam A G 2: 14,117,473 I128V probably damaging Het
Sytl2 A G 7: 90,375,590 D262G possibly damaging Het
Taf2 G A 15: 55,059,988 R298C probably damaging Het
Tcl1b5 A T 12: 105,180,003 T112S probably benign Het
Trim33 T C 3: 103,331,727 S674P possibly damaging Het
Vmn1r44 T C 6: 89,893,863 I197T probably benign Het
Wdtc1 C T 4: 133,302,382 probably null Het
Zfp583 G T 7: 6,323,822 probably null Het
Zfyve16 T A 13: 92,505,677 I1213F probably damaging Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
pungent UTSW 1 84793915 missense possibly damaging 0.70
spices UTSW 1 84793875 missense probably benign 0.10
sulfuric UTSW 1 84759050 missense probably benign 0.19
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
R7818:Trip12 UTSW 1 84760806 missense probably damaging 1.00
R7918:Trip12 UTSW 1 84745063 missense probably damaging 0.98
R8221:Trip12 UTSW 1 84766050 missense possibly damaging 0.80
R8336:Trip12 UTSW 1 84766041 missense probably benign 0.37
R8373:Trip12 UTSW 1 84795767 missense probably damaging 0.98
R8719:Trip12 UTSW 1 84745069 missense probably damaging 0.98
R8771:Trip12 UTSW 1 84743297 unclassified probably benign
R8997:Trip12 UTSW 1 84793875 missense probably benign 0.10
R9146:Trip12 UTSW 1 84794160 missense possibly damaging 0.89
R9236:Trip12 UTSW 1 84725829 missense probably damaging 1.00
R9338:Trip12 UTSW 1 84749298 missense probably damaging 0.99
R9391:Trip12 UTSW 1 84795752 missense probably benign 0.00
R9516:Trip12 UTSW 1 84757494 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTCAGGCATACAGACATTAGG -3'
(R):5'- GCCTGTCCACATGAGAGATTTAAG -3'

Sequencing Primer
(F):5'- GATCAAGTGAAGGCTGTGACTCC -3'
(R):5'- TTAAGAGGACTATTCTTGCTAGGAG -3'
Posted On 2020-06-30