Incidental Mutation 'R5914:Trip12'
ID461158
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Namethyroid hormone receptor interactor 12
Synonyms6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location84721189-84840516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84763458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 571 (E571G)
Ref Sequence ENSEMBL: ENSMUSP00000139563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: E577G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: E577G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185672
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: E577G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: E577G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: E571G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: E571G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186894
AA Change: E577G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: E577G

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 3e-20 SMART
PDB:1WA5|B 447 641 7e-6 PDB
Blast:ARM 476 516 6e-6 BLAST
WWE 764 839 6.9e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190464
Meta Mutation Damage Score 0.3835 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAATTATATGACTGGACAACAC -3'
(R):5'- GTTGAACTACATTGTGCTAATTCCTTG -3'

Sequencing Primer
(F):5'- TGACTGGACAACACATTTCAATAG -3'
(R):5'- GACTGTAGCTCTGTAAGATGCAC -3'
Posted On2017-02-28