Mutagenetix > Incidental Mutation

Incidental Mutation 'R9443:Cenpe'

713731

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9443 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 135270848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2405 (D2405E)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062893
AA Change: D2405E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: D2405E

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230104L09Rik	C	T	2: 148,847,958	E92K	probably damaging	Het
Adad1	T	C	3: 37,091,991	Y503H	probably benign	Het
Adck1	T	C	12: 88,371,780		probably null	Het
Afap1l1	T	C	18: 61,746,788	D337G	probably damaging	Het
Afg1l	G	A	10: 42,313,591	T448M	probably damaging	Het
Aqp6	T	C	15: 99,601,528	S41P		Het
Atad5	T	G	11: 80,132,562	V1500G	probably benign	Het
Btbd18	T	A	2: 84,667,180	D387E	probably benign	Het
Catsperd	A	G	17: 56,662,720	N605D	possibly damaging	Het
Ccdc24	C	T	4: 117,871,158	V102I	probably benign	Het
Cfap46	T	C	7: 139,615,107	D2249G		Het
Chrm1	A	T	19: 8,678,186	Y85F	possibly damaging	Het
Clstn3	C	T	6: 124,451,399	G465S	probably damaging	Het
Col7a1	G	A	9: 108,955,991	G262D	unknown	Het
Copg2	T	C	6: 30,750,579	T736A	probably benign	Het
Coro2b	T	C	9: 62,425,798	E435G	probably benign	Het
Cp	A	T	3: 19,978,919	I637F	possibly damaging	Het
Cpne7	T	C	8: 123,126,672	F239L	probably damaging	Het
Cul2	T	A	18: 3,434,041	Y679*	probably null	Het
Dhx8	T	C	11: 101,764,914	Y1158H	probably damaging	Het
Eda	G	T	X: 99,976,169	R130L	unknown	Het
Elp6	T	A	9: 110,320,936	V265D	probably damaging	Het
Eomes	A	G	9: 118,484,572	T562A		Het
Fam187b	A	T	7: 30,977,642	E192V	probably damaging	Het
Foxi1	T	C	11: 34,205,671	T320A	probably benign	Het
Gga1	C	T	15: 78,881,047	T18I	possibly damaging	Het
Gm13128	T	A	4: 144,333,108	I463N	possibly damaging	Het
Gm34653	C	T	2: 34,838,611	Q141*	probably null	Het
Grik4	T	A	9: 42,659,741	M223L	probably benign	Het
Hdac7	T	C	15: 97,802,471	N594S	probably benign	Het
Ifnar1	C	T	16: 91,495,479	P207L	probably benign	Het
Itpr3	T	G	17: 27,105,549	F1235C	probably damaging	Het
Klhdc4	A	G	8: 121,797,026	S484P	possibly damaging	Het
Kmt2c	A	G	5: 25,310,047	S2933P	probably damaging	Het
Lama5	T	A	2: 180,201,729	H475L	probably benign	Het
Ly6g6f	A	G	17: 35,080,850	L292P	possibly damaging	Het
Macf1	T	A	4: 123,471,875	Q3031L	probably benign	Het
Mbd5	T	G	2: 49,256,700	S307R	probably damaging	Het
Mertk	T	C	2: 128,762,109	F388L	probably benign	Het
Mmp11	A	G	10: 75,926,899	F240S	probably damaging	Het
Mroh1	T	A	15: 76,434,764	F949I	probably damaging	Het
Mroh2b	T	C	15: 4,944,339	L1113P	probably damaging	Het
Ndufv1	C	A	19: 4,007,614	A454S	probably benign	Het
Olfr1176	T	A	2: 88,340,020	W152R	probably damaging	Het
Olfr663	T	C	7: 104,703,614	S16P	probably benign	Het
Olfr70	A	G	4: 43,696,591	L194P	probably damaging	Het
Osbpl1a	C	A	18: 12,898,187	D329Y	probably benign	Het
Pcdh1	C	A	18: 38,197,580	R929L	probably damaging	Het
Phactr2	C	T	10: 13,247,097	R427K	probably benign	Het
Pip5k1c	T	C	10: 81,317,350	Y670H	probably damaging	Het
Plbd1	T	A	6: 136,634,557	N241Y	probably damaging	Het
Pmvk	C	A	3: 89,467,649	Q139K	probably benign	Het
Rab3gap2	T	A	1: 185,235,326	C136S	probably damaging	Het
Rcor3	A	G	1: 192,101,750	V396A	probably damaging	Het
Rgs20	C	A	1: 4,912,406	E147*	probably null	Het
Rnf167	G	T	11: 70,649,951	L170F	probably damaging	Het
Scn9a	T	C	2: 66,565,209	T164A	probably damaging	Het
Slc52a3	A	T	2: 152,004,379	I87F	probably benign	Het
Sntn	A	T	14: 13,682,364	M146L		Het
Svep1	C	T	4: 58,179,697	R182H	possibly damaging	Het
Taar7f	A	G	10: 24,050,413	I302V	probably benign	Het
Tm4sf20	T	C	1: 82,768,369	I17V	probably benign	Het
Traf1	T	C	2: 34,946,736	T270A	probably benign	Het
Trpm5	C	T	7: 143,085,123	E304K	probably benign	Het
Ttc37	A	G	13: 76,118,169	Q210R	probably benign	Het
Ttll8	T	C	15: 88,925,660	D311G	possibly damaging	Het
Unc79	T	A	12: 103,070,776	F608I	probably damaging	Het
Vmn2r11	A	T	5: 109,047,293	C722*	probably null	Het
Wdr7	A	G	18: 63,720,336	T36A	probably damaging	Het
Ybx2	C	T	11: 69,940,362	P261L		Het
Zfp101	C	T	17: 33,382,444	V113I	probably benign	Het
Zfp260	T	C	7: 30,104,824	S50P	probably benign	Het
Zfp319	A	T	8: 95,328,294	F427Y	probably benign	Het
Zfp369	T	C	13: 65,296,533	S497P	possibly damaging	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AACTCTCAACTCTCCAATGAGG -3'
(R):5'- TGTGAAGTAACCACACCGCG -3'

Sequencing Primer
(F):5'- TCTCAACTCTCCAATGAGGTTAAAAC -3'
(R):5'- TGAGTTCTCACAGCTGAGCAG -3'

Posted On

2022-06-15