Incidental Mutation 'R6383:Cenpe'
ID515422
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6383 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135251528 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1849 (E1849G)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
Predicted Effect probably damaging
Transcript: ENSMUST00000062893
AA Change: E1849G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: E1849G

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,247,184 M2497K probably benign Het
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Asic1 T C 15: 99,698,880 L519P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chia1 A G 3: 106,131,811 T406A probably benign Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Irx4 T C 13: 73,267,713 M207T possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Myo1h A G 5: 114,336,264 I439V probably damaging Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Srpk1 A G 17: 28,590,062 S648P probably damaging Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Vwce T A 19: 10,659,592 C679* probably null Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7926:Cenpe UTSW 3 135232959 nonsense probably null
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACTCCTTATAGTGAGCGCCTC -3'
(R):5'- AGGACGCACACTTACCTTAAG -3'

Sequencing Primer
(F):5'- TGGAGACATGGCTCAGTAATCCTC -3'
(R):5'- AAGCATGGCTTCTCTCAGG -3'
Posted On2018-05-04