Mutagenetix > Incidental Mutation

Incidental Mutation 'R2062:Cenpe'

228740

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

040067-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 135222321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062893

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
A2ml1	A	T	6: 128,552,308	M957K	probably benign	Het
Adam7	C	A	14: 68,505,161	V668F	probably benign	Het
Adcy7	T	G	8: 88,312,274	L306R	probably damaging	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Alox12e	G	A	11: 70,316,002	R620W	probably damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ano7	T	C	1: 93,390,313	V249A	probably benign	Het
Aox1	T	C	1: 58,059,192		probably null	Het
Asah2	A	T	19: 32,024,874	V290E	probably damaging	Het
Ascc2	A	T	11: 4,681,496	M646L	probably benign	Het
Atxn2l	T	A	7: 126,495,866	K421N	probably damaging	Het
Cars2	T	C	8: 11,547,747	I110V	probably damaging	Het
Ccdc74a	A	G	16: 17,650,026	N249S	probably benign	Het
Clptm1l	C	T	13: 73,607,723	Q153*	probably null	Het
Cnep1r1	G	T	8: 88,118,817		probably benign	Het
Cyp2d37-ps	C	T	15: 82,690,088		noncoding transcript	Het
Cyp3a25	A	G	5: 145,986,969		probably benign	Het
Dis3l	G	T	9: 64,339,573	Q67K	probably benign	Het
Dnah1	A	G	14: 31,271,129	V2936A	probably damaging	Het
Dnah5	C	T	15: 28,366,270	R2710C	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Dvl3	G	A	16: 20,526,351	S361N	probably benign	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Eif2ak3	T	C	6: 70,904,197	V1085A	probably benign	Het
Eif3b	T	C	5: 140,426,453	Y226H	probably damaging	Het
Endov	T	C	11: 119,499,582	F12S	probably damaging	Het
Ercc1	A	G	7: 19,354,370	*37W	probably null	Het
Evi2a	G	A	11: 79,527,767	Q6*	probably null	Het
Faah	C	T	4: 115,998,573	V552M	probably damaging	Het
Fat1	T	A	8: 45,024,332	N2138K	probably damaging	Het
Fat1	T	A	8: 45,026,704	V2929E	probably damaging	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm6327	A	T	16: 12,761,115		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gtf2f2	A	G	14: 75,917,696	S142P	possibly damaging	Het
Hspg2	A	T	4: 137,559,367	T3666S	possibly damaging	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Iqgap1	G	A	7: 80,723,979	Q1421*	probably null	Het
Itga3	T	A	11: 95,054,076	Q802L	possibly damaging	Het
Lonp2	A	G	8: 86,665,775	T490A	probably damaging	Het
Lztr1	T	C	16: 17,509,670	V79A	probably damaging	Het
Mast4	C	T	13: 102,759,093	E736K	probably benign	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Myof	A	G	19: 37,915,746	V2A	possibly damaging	Het
Naf1	A	G	8: 66,887,780	D414G	probably damaging	Het
Nav3	G	A	10: 109,720,021	T1683M	probably damaging	Het
Nbea	A	G	3: 56,086,157		probably benign	Het
Nebl	A	T	2: 17,397,121	M427K	probably benign	Het
Ngdn	T	C	14: 55,022,107	V205A	possibly damaging	Het
Nup133	C	A	8: 123,914,575	D869Y	probably damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr1034	A	G	2: 86,046,955	T158A	probably damaging	Het
Olfr1404	T	C	1: 173,215,710	F20L	probably benign	Het
Olfr322	G	T	11: 58,665,982	C141F	probably damaging	Het
Olfr324	A	G	11: 58,597,570	N58S	probably damaging	Het
Olfr775	T	A	10: 129,251,132	Y199*	probably null	Het
Park7	T	C	4: 150,905,275	N76S	probably benign	Het
Pcdh8	A	T	14: 79,768,211	S912R	probably damaging	Het
Pkhd1	A	G	1: 20,201,335	I2998T	probably damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Ppard	A	G	17: 28,299,689	H388R	probably damaging	Het
Psma1	A	G	7: 114,269,766	S142P	possibly damaging	Het
Pth2r	T	C	1: 65,343,562	I158T	probably damaging	Het
Rbl2	C	A	8: 91,106,739	P714Q	probably damaging	Het
Rexo2	A	T	9: 48,474,513	S104T	possibly damaging	Het
Sema5a	T	C	15: 32,609,217		probably benign	Het
Sun2	A	G	15: 79,738,651	L109P	probably damaging	Het
Tdg	A	G	10: 82,641,534	T116A	probably benign	Het
Terb1	A	T	8: 104,468,748	M587K	possibly damaging	Het
Tex43	C	T	18: 56,588,463	Q25*	probably null	Het
Tmcc1	C	T	6: 116,043,058	V118M	probably benign	Het
Tnfsf11	T	A	14: 78,278,922	N202I	probably damaging	Het
Togaram2	T	C	17: 71,716,365	S759P	probably benign	Het
Ttc7b	G	A	12: 100,325,689	A208V	probably damaging	Het
Tti2	T	C	8: 31,154,310		probably benign	Het
Wnk1	T	C	6: 119,928,157		probably null	Het
Zfyve26	T	C	12: 79,284,032		probably null	Het
Zfyve28	T	C	5: 34,234,337	M157V	probably null	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGAGGTCAGGCTTCAGCATC -3'
(R):5'- TGACCTTGCACAGCACATG -3'

Sequencing Primer
(F):5'- AGGCTTCAGCATCCATCGTAG -3'
(R):5'- GTGCACTAAAATGTCACTGCATCCTG -3'

Posted On

2014-09-17