Mutagenetix > Incidental Mutation

Incidental Mutation 'R8069:Cenpe'

620152

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8069 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135243718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 88 (G88D)

Ref Sequence

ENSEMBL: ENSMUSP00000143435 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062893
AA Change: G1316D

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: G1316D

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000197369
AA Change: G88D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328
AA Change: G88D

Domain	Start	End	E-Value	Type
coiled coil region	2	49	N/A	INTRINSIC
coiled coil region	85	172	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	T	A	9: 4,296,823	D261V	probably benign	Het
Abca8a	T	C	11: 110,090,050	Y54C	probably damaging	Het
Adad2	T	C	8: 119,616,007	S431P	probably benign	Het
Adam18	A	G	8: 24,628,230	Y557H	possibly damaging	Het
Adam5	C	T	8: 24,813,525	E129K	probably damaging	Het
Adgra2	T	C	8: 27,119,223	V824A	probably benign	Het
Armc12	A	T	17: 28,532,436	K135*	probably null	Het
Aup1	C	T	6: 83,055,929	Q215*	probably null	Het
AW146154	G	A	7: 41,480,511	R394C	probably benign	Het
Canx	T	G	11: 50,311,704	D25A	possibly damaging	Het
Ccnf	A	G	17: 24,225,015	L593P	probably damaging	Het
Cd40	A	T	2: 165,056,775	I41F	unknown	Het
Cdh1	C	T	8: 106,657,773	A291V	probably benign	Het
Cdhr2	A	T	13: 54,731,070	I963F	probably damaging	Het
Cep295	T	A	9: 15,322,586	T2305S	possibly damaging	Het
Clcn4	T	C	7: 7,296,759	R24G	probably damaging	Het
Cnot7	T	C	8: 40,507,473	N98S	possibly damaging	Het
Defa3	T	G	8: 21,288,272	C91G	probably damaging	Het
Dennd2c	T	C	3: 103,165,130	F844L	probably damaging	Het
Dido1	T	C	2: 180,660,912	D1733G	probably benign	Het
Dnah7b	G	A	1: 46,224,706	W2116*	probably null	Het
Dnaja3	T	C	16: 4,684,267	V45A	probably benign	Het
Efcab7	T	A	4: 99,829,378	S11T	unknown	Het
Enpp2	T	A	15: 54,847,301	K744N	probably damaging	Het
Fam171b	CCAGCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGCAGC	2: 83,812,874		probably benign	Het
Fdxacb1	T	G	9: 50,768,835	F107C	probably damaging	Het
Fnbp1	A	T	2: 31,036,594	Y433N	probably damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gm15446	T	A	5: 109,940,440	Y6*	probably null	Het
Gm45140	T	C	6: 87,819,569	H66R		Het
Grin3b	G	A	10: 79,977,034	R981Q	unknown	Het
Ipp	T	G	4: 116,510,856	I95M	probably benign	Het
Iqca	A	G	1: 90,045,744	F769L	probably damaging	Het
Jkamp	C	T	12: 72,090,058	L67F	probably damaging	Het
Llgl2	T	A	11: 115,853,286	M773K	probably damaging	Het
Man2b1	A	G	8: 85,097,045	T973A	probably benign	Het
Mcm2	T	C	6: 88,892,057	Y271C	probably damaging	Het
Msl2	T	C	9: 101,100,960	S178P	probably benign	Het
Myo7a	G	T	7: 98,083,626	S648*	probably null	Het
Neurl1b	G	T	17: 26,432,227	V158F	probably damaging	Het
Nkain2	A	G	10: 32,890,038	V142A	unknown	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Odf3	A	T	7: 140,850,302	T201S	probably benign	Het
Olfr1124	A	T	2: 87,435,020	N178Y	possibly damaging	Het
Olfr259	A	G	2: 87,108,067	Y107H	probably damaging	Het
Oma1	A	T	4: 103,319,035		probably benign	Het
Plekhg6	T	C	6: 125,363,046	T784A	probably benign	Het
Prtg	T	C	9: 72,844,983	I217T	probably benign	Het
Ptx4	T	C	17: 25,122,779	F76S	probably damaging	Het
Rap1b	A	C	10: 117,821,609	I55S	probably damaging	Het
Sftpd	T	C	14: 41,172,581	T294A	probably benign	Het
Spg11	C	T	2: 122,113,156	V172I	probably benign	Het
Srms	T	A	2: 181,206,958	H363L	probably damaging	Het
Tbc1d13	A	T	2: 30,147,403	M266L	probably damaging	Het
Tbc1d2	A	C	4: 46,649,737	C100G	possibly damaging	Het
Tdg	A	T	10: 82,638,793	Q39L	probably benign	Het
Tiam1	G	A	16: 89,789,258	A1547V	probably benign	Het
Trpm1	A	G	7: 64,208,970	E380G	possibly damaging	Het
Unc13b	T	G	4: 43,177,597	D2808E	unknown	Het
Usp25	A	T	16: 77,069,055	D287V	possibly damaging	Het
Zfp648	A	T	1: 154,204,116	Q7L	probably benign	Het
Zfp931	T	C	2: 178,067,916	R226G	probably benign	Het
Zfyve9	T	A	4: 108,685,018	E201D	probably benign	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GATAAGATTGTCCTGACCTTTTCCATC -3'
(R):5'- GTGAGATTTTAACTGTGACACAAGC -3'

Sequencing Primer
(F):5'- GTCCTGACCTTTTCCATCTAAAAG -3'
(R):5'- TTAATCCCAGCGCTTGAGAG -3'

Posted On

2020-01-23