Mutagenetix > Incidental Mutation

Incidental Mutation 'R9447:Dhx57'

714032

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene?

Probably non essential (E-score: 0.178) question?

Stock #

R9447 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80242094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1294 (V1294A)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

AlphaFold

Q6P5D3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038166
AA Change: V1241A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V1241A

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086555
AA Change: V1294A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V1294A

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	G	A	4: 126,508,358	P572S	probably benign	Het
Akr1c19	A	G	13: 4,246,839	I295V	probably benign	Het
Cadps2	A	T	6: 23,323,298	I1007K	probably damaging	Het
Ccdc144b	A	G	3: 36,020,046	V318A	possibly damaging	Het
Cd47	C	A	16: 49,895,459	T196K		Het
Cdrt4	T	G	11: 62,992,592	L40R	probably damaging	Het
Cox16	A	T	12: 81,359,335	C72S	probably benign	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Daxx	A	T	17: 33,913,273	D497V	unknown	Het
Ddt	A	G	10: 75,772,837	V62A	possibly damaging	Het
Dnaaf5	A	G	5: 139,177,988	T667A	probably damaging	Het
Dnase2a	A	C	8: 84,909,157	S90R	probably damaging	Het
Dytn	A	G	1: 63,661,143	V276A		Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Enpp6	A	T	8: 47,030,565	R131W	probably damaging	Het
Epm2a	C	T	10: 11,448,688	H174Y	possibly damaging	Het
Fam160a2	G	T	7: 105,384,948	T492K	probably benign	Het
Fcho1	A	G	8: 71,717,269	L70P	probably damaging	Het
Fstl4	G	T	11: 53,186,339	C641F	probably damaging	Het
Ganab	C	T	19: 8,909,530	H327Y	probably damaging	Het
Gkn1	A	G	6: 87,346,340	Y164H	probably benign	Het
Gm10037	A	G	13: 67,833,834	E55G	probably damaging	Het
Gm5538	T	A	3: 59,743,630	Y58N	probably damaging	Het
Hpf1	A	G	8: 60,895,584	D111G	probably damaging	Het
Hs3st2	C	T	7: 121,393,066	R113W	probably damaging	Het
Ighm	A	T	12: 113,421,174	L353Q		Het
Ksr1	T	C	11: 79,018,333	D782G	unknown	Het
Lpin2	A	G	17: 71,232,092	K392E	unknown	Het
Lrrc4	A	G	6: 28,830,651	S322P	probably benign	Het
Man2a1	T	C	17: 64,659,006	V313A	possibly damaging	Het
Mctp1	A	G	13: 76,579,785	S9G	probably benign	Het
Morn5	A	T	2: 36,079,513		probably null	Het
Mroh2b	C	T	15: 4,931,341	A795V	probably damaging	Het
Ncf4	G	T	15: 78,262,299	A310S	probably benign	Het
Nedd4	T	C	9: 72,670,099	Y69H	probably benign	Het
Nras	T	C	3: 103,060,357	F90L	possibly damaging	Het
Nrxn3	T	C	12: 89,254,908	F113L	probably benign	Het
Ntsr1	C	T	2: 180,538,747	T282I	probably benign	Het
Olfr396-ps1	G	T	11: 73,928,791	C189F	probably benign	Het
Osbpl3	T	A	6: 50,344,877	K310*	probably null	Het
Pcca	T	C	14: 122,616,878	V194A	probably damaging	Het
Plekha5	A	G	6: 140,579,466	Y900C	probably damaging	Het
Prss22	T	C	17: 23,993,863	D300G	probably benign	Het
Rad17	A	T	13: 100,627,611	Y451N	probably damaging	Het
Rnf181	G	T	6: 72,360,587	T97K	probably damaging	Het
Sec24d	T	C	3: 123,290,513	S114P	probably benign	Het
Siae	C	A	9: 37,646,447	Q517K	probably benign	Het
Smurf2	A	T	11: 106,824,722	V653D	probably damaging	Het
Sqor	C	A	2: 122,807,600	T359K	possibly damaging	Het
Taf6	A	T	5: 138,178,708	*637R	probably null	Het
Tas2r109	A	C	6: 132,980,307	M220R	probably damaging	Het
Tlr2	T	A	3: 83,841,138		probably null	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem8b	T	G	4: 43,685,766	L179R	probably damaging	Het
Tnfrsf10b	T	A	14: 69,776,159	H179Q	probably damaging	Het
Trip11	T	A	12: 101,883,889	K1305N	probably damaging	Het
Ttn	C	A	2: 76,752,518	W22677L	probably damaging	Het
Ube2r2	T	C	4: 41,190,655	V183A	probably damaging	Het
Ubqln4	T	A	3: 88,556,817	D208E	probably benign	Het
Ugt2a3	T	A	5: 87,325,471	N529I	probably benign	Het
Vmn1r125	A	G	7: 21,272,702	N175S	probably benign	Het
Xirp2	T	A	2: 67,508,606	I397K	probably damaging	Het
Zfp821	G	A	8: 109,724,184	V270I	probably damaging	Het
Zfp935	A	G	13: 62,455,028	V99A	possibly damaging	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
R9210:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9212:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9562:Dhx57	UTSW	17	80254388	missense	probably damaging	1.00
R9669:Dhx57	UTSW	17	80245701	missense	probably benign	0.09
R9717:Dhx57	UTSW	17	80275018	missense	probably damaging	1.00
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CGAGCCTTTAAGCAGATCAGCTG -3'
(R):5'- GGTCTGCAAAGCGTTAGATGC -3'

Sequencing Primer
(F):5'- AAGCAGATCAGCTGTCCCTTTAC -3'
(R):5'- TTGATATCTAATAACAACAGCAAGCC -3'

Posted On

2022-06-15