Incidental Mutation 'R9447:Dhx57'
ID 714032
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R9447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80238304-80290476 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80242094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1294 (V1294A)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably damaging
Transcript: ENSMUST00000038166
AA Change: V1241A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V1241A

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: V1294A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V1294A

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 G A 4: 126,508,358 P572S probably benign Het
Akr1c19 A G 13: 4,246,839 I295V probably benign Het
Cadps2 A T 6: 23,323,298 I1007K probably damaging Het
Ccdc144b A G 3: 36,020,046 V318A possibly damaging Het
Cd47 C A 16: 49,895,459 T196K Het
Cdrt4 T G 11: 62,992,592 L40R probably damaging Het
Cox16 A T 12: 81,359,335 C72S probably benign Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Daxx A T 17: 33,913,273 D497V unknown Het
Ddt A G 10: 75,772,837 V62A possibly damaging Het
Dnaaf5 A G 5: 139,177,988 T667A probably damaging Het
Dnase2a A C 8: 84,909,157 S90R probably damaging Het
Dytn A G 1: 63,661,143 V276A Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Enpp6 A T 8: 47,030,565 R131W probably damaging Het
Epm2a C T 10: 11,448,688 H174Y possibly damaging Het
Fam160a2 G T 7: 105,384,948 T492K probably benign Het
Fcho1 A G 8: 71,717,269 L70P probably damaging Het
Fstl4 G T 11: 53,186,339 C641F probably damaging Het
Ganab C T 19: 8,909,530 H327Y probably damaging Het
Gkn1 A G 6: 87,346,340 Y164H probably benign Het
Gm10037 A G 13: 67,833,834 E55G probably damaging Het
Gm5538 T A 3: 59,743,630 Y58N probably damaging Het
Hpf1 A G 8: 60,895,584 D111G probably damaging Het
Hs3st2 C T 7: 121,393,066 R113W probably damaging Het
Ighm A T 12: 113,421,174 L353Q Het
Ksr1 T C 11: 79,018,333 D782G unknown Het
Lpin2 A G 17: 71,232,092 K392E unknown Het
Lrrc4 A G 6: 28,830,651 S322P probably benign Het
Man2a1 T C 17: 64,659,006 V313A possibly damaging Het
Mctp1 A G 13: 76,579,785 S9G probably benign Het
Morn5 A T 2: 36,079,513 probably null Het
Mroh2b C T 15: 4,931,341 A795V probably damaging Het
Ncf4 G T 15: 78,262,299 A310S probably benign Het
Nedd4 T C 9: 72,670,099 Y69H probably benign Het
Nras T C 3: 103,060,357 F90L possibly damaging Het
Nrxn3 T C 12: 89,254,908 F113L probably benign Het
Ntsr1 C T 2: 180,538,747 T282I probably benign Het
Olfr396-ps1 G T 11: 73,928,791 C189F probably benign Het
Osbpl3 T A 6: 50,344,877 K310* probably null Het
Pcca T C 14: 122,616,878 V194A probably damaging Het
Plekha5 A G 6: 140,579,466 Y900C probably damaging Het
Prss22 T C 17: 23,993,863 D300G probably benign Het
Rad17 A T 13: 100,627,611 Y451N probably damaging Het
Rnf181 G T 6: 72,360,587 T97K probably damaging Het
Sec24d T C 3: 123,290,513 S114P probably benign Het
Siae C A 9: 37,646,447 Q517K probably benign Het
Smurf2 A T 11: 106,824,722 V653D probably damaging Het
Sqor C A 2: 122,807,600 T359K possibly damaging Het
Taf6 A T 5: 138,178,708 *637R probably null Het
Tas2r109 A C 6: 132,980,307 M220R probably damaging Het
Tlr2 T A 3: 83,841,138 probably null Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem8b T G 4: 43,685,766 L179R probably damaging Het
Tnfrsf10b T A 14: 69,776,159 H179Q probably damaging Het
Trip11 T A 12: 101,883,889 K1305N probably damaging Het
Ttn C A 2: 76,752,518 W22677L probably damaging Het
Ube2r2 T C 4: 41,190,655 V183A probably damaging Het
Ubqln4 T A 3: 88,556,817 D208E probably benign Het
Ugt2a3 T A 5: 87,325,471 N529I probably benign Het
Vmn1r125 A G 7: 21,272,702 N175S probably benign Het
Xirp2 T A 2: 67,508,606 I397K probably damaging Het
Zfp821 G A 8: 109,724,184 V270I probably damaging Het
Zfp935 A G 13: 62,455,028 V99A possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80245763 missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80275490 missense probably benign 0.18
R8403:Dhx57 UTSW 17 80278289 missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80254424 missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80270365 critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80268909 missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80254388 missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80245701 missense probably benign 0.09
R9717:Dhx57 UTSW 17 80275018 missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGAGCCTTTAAGCAGATCAGCTG -3'
(R):5'- GGTCTGCAAAGCGTTAGATGC -3'

Sequencing Primer
(F):5'- AAGCAGATCAGCTGTCCCTTTAC -3'
(R):5'- TTGATATCTAATAACAACAGCAAGCC -3'
Posted On 2022-06-15