Incidental Mutation 'R1061:Wrap53'
ID 94507
Institutional Source Beutler Lab
Gene Symbol Wrap53
Ensembl Gene ENSMUSG00000041346
Gene Name WD repeat containing, antisense to Trp53
Synonyms Wdr79
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 69561758-69580255 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69562400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 405 (L405P)
Ref Sequence ENSEMBL: ENSMUSP00000047825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004036] [ENSMUST00000048139]
AlphaFold Q8VC51
Predicted Effect probably benign
Transcript: ENSMUST00000004036
SMART Domains Protein: ENSMUSP00000004036
Gene: ENSMUSG00000003934

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Ephrin 28 167 2.8e-45 PFAM
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000048139
AA Change: L405P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047825
Gene: ENSMUSG00000041346
AA Change: L405P

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
WD40 144 181 5.75e-1 SMART
Blast:WD40 197 242 3e-18 BLAST
WD40 245 288 1.67e-1 SMART
WD40 295 337 3.58e-1 SMART
WD40 340 380 1.19e-6 SMART
WD40 384 425 8.25e0 SMART
Blast:WD40 435 471 1e-14 BLAST
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155894
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential component of the telomerase holoenzyme complex, a ribonucleoprotein complex required for telomere synthesis. This protein is enriched in Cajal bodies, nuclear sites of RNP processing that are important for telomerase function. It interacts with dyskerin, TERT and TERC, other components of active telomerase, and with small Cajal body RNAs (scaRNAs), which are involved in modifying splicing RNAs. This mRNA also functions as a p53 antisense transcript, that regulates endogenous p53 mRNA levels and further induction of p53 protein by targeting the 5' untranslated region of p53 mRNA. Alternatively spliced transcript variants which differ only in the 5' UTR have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Wrap53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Wrap53 APN 11 69562740 missense possibly damaging 0.72
IGL02342:Wrap53 APN 11 69563591 missense probably damaging 0.99
P4748:Wrap53 UTSW 11 69562205 missense probably damaging 1.00
R0021:Wrap53 UTSW 11 69563886 missense probably damaging 0.99
R0060:Wrap53 UTSW 11 69563430 missense possibly damaging 0.88
R0682:Wrap53 UTSW 11 69562446 missense probably damaging 1.00
R1708:Wrap53 UTSW 11 69563935 nonsense probably null
R1868:Wrap53 UTSW 11 69562164 missense probably null 0.46
R3113:Wrap53 UTSW 11 69563318 missense probably benign 0.31
R5091:Wrap53 UTSW 11 69562447 nonsense probably null
R5119:Wrap53 UTSW 11 69563932 missense possibly damaging 0.84
R6263:Wrap53 UTSW 11 69562793 nonsense probably null
R6337:Wrap53 UTSW 11 69577685 missense probably benign 0.30
R6537:Wrap53 UTSW 11 69563868 missense possibly damaging 0.49
R6628:Wrap53 UTSW 11 69562144 missense probably benign 0.00
R7111:Wrap53 UTSW 11 69562479 missense probably damaging 1.00
R7138:Wrap53 UTSW 11 69563868 missense probably benign 0.32
R7431:Wrap53 UTSW 11 69578487 missense possibly damaging 0.88
X0063:Wrap53 UTSW 11 69578537 missense probably benign
Z1088:Wrap53 UTSW 11 69578498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAAAGTCACCACGGGTTCCAG -3'
(R):5'- AGCCCAAAGCATGTGGGTAGTCAG -3'

Sequencing Primer
(F):5'- TGCTGTCGTCACTAAGAGC -3'
(R):5'- CATGTGGGTAGTCAGGAGTG -3'
Posted On 2014-01-05