Mutagenetix > Incidental Mutation

Incidental Mutation 'R1061:Rif1'

94429

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

039147-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1061 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

GCCACCA to GCCA at 52110324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069794
AA Change: 1264

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: 1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112693
AA Change: P1264

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: P1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125322

Predicted Effect

probably benign
Transcript: ENSMUST00000125376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Predicted Effect

probably benign
Transcript: ENSMUST00000152178

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,277,809	A715T	probably benign	Het
Ampd2	A	G	3: 108,075,689	Y641H	probably damaging	Het
Aqp4	A	T	18: 15,398,191	V171E	probably damaging	Het
Arid4a	T	A	12: 71,074,955	S381R	probably damaging	Het
Armc8	T	G	9: 99,537,731	N51H	probably damaging	Het
Asic5	T	A	3: 82,021,001	Y424N	probably damaging	Het
Bcl11a	A	T	11: 24,164,069	K471*	probably null	Het
Birc6	A	G	17: 74,689,312	T4494A	probably damaging	Het
Btbd9	A	G	17: 30,527,435	I139T	probably benign	Het
Ccdc114	T	C	7: 45,941,755	I218T	probably damaging	Het
Ccdc60	C	A	5: 116,172,468	R178S	possibly damaging	Het
Cd163	C	T	6: 124,309,169	A226V	probably benign	Het
Cog1	T	G	11: 113,652,037	S170A	probably benign	Het
Cwc15	T	C	9: 14,507,915	L169P	probably damaging	Het
Cyp3a25	A	T	5: 145,986,833	D333E	probably benign	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Dlc1	T	A	8: 36,858,051	T367S	probably benign	Het
Dnah17	T	C	11: 118,052,688	D3183G	possibly damaging	Het
Eif2a	T	A	3: 58,545,065	Y165*	probably null	Het
Eml6	T	C	11: 29,777,267	D1285G	probably damaging	Het
Fam92b	C	A	8: 120,169,704		probably null	Het
Fasn	T	C	11: 120,822,182		probably null	Het
Fbn1	T	C	2: 125,345,963	T1549A	probably benign	Het
Fezf2	T	C	14: 12,342,713	Y384C	probably damaging	Het
Flvcr1	A	T	1: 191,008,173	V550E	probably benign	Het
Gcm2	A	G	13: 41,105,871	W41R	probably damaging	Het
Gli2	A	T	1: 118,854,517	M160K	possibly damaging	Het
Gpr61	C	T	3: 108,150,307	R346H	probably damaging	Het
Hoxa5	A	T	6: 52,204,155	S66T	probably benign	Het
Hsph1	A	T	5: 149,618,418	V781D	possibly damaging	Het
Kdm3b	G	A	18: 34,796,862	V220M	probably damaging	Het
Klhl25	T	A	7: 75,866,520	Y391*	probably null	Het
Mc2r	A	T	18: 68,407,809	Y138N	probably damaging	Het
Mtap	C	A	4: 89,156,584	D106E	probably benign	Het
Nup43	G	T	10: 7,667,671	W37L	probably damaging	Het
Nxpe2	T	A	9: 48,326,363	E197D	probably damaging	Het
Olfr1098	A	T	2: 86,922,782	V250D	possibly damaging	Het
Olfr484	T	C	7: 108,124,456	Y269C	probably damaging	Het
Olfr544	T	A	7: 102,484,114	*335C	probably null	Het
Olfr934	C	A	9: 38,982,483	C187F	probably damaging	Het
Pitrm1	A	G	13: 6,555,575	H186R	probably damaging	Het
Pklr	C	T	3: 89,144,881	R467C	probably damaging	Het
Plxna2	A	G	1: 194,644,093	N112D	probably damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp3cb	A	C	14: 20,508,614		probably null	Het
R3hcc1l	C	T	19: 42,583,426	R135*	probably null	Het
Ralyl	A	C	3: 14,115,701	D68A	probably damaging	Het
S100a1	T	C	3: 90,511,312	N65S	probably damaging	Het
Scn11a	A	T	9: 119,795,663	M531K	probably damaging	Het
Slc5a5	T	A	8: 70,890,221	M232L	probably benign	Het
Tet3	A	T	6: 83,373,323	N1054K	probably damaging	Het
Tg	A	G	15: 66,698,559	N1427D	probably benign	Het
Tns1	A	C	1: 73,917,672	V530G	probably damaging	Het
Trcg1	C	A	9: 57,245,873	Q600K	possibly damaging	Het
Tshz3	A	G	7: 36,768,706	E40G	probably damaging	Het
Usp34	T	C	11: 23,384,420	F1138S	possibly damaging	Het
Vmn2r26	C	T	6: 124,061,644	T726I	probably benign	Het
Vmn2r97	A	T	17: 18,928,178	R112*	probably null	Het
Vwa2	G	T	19: 56,908,994	R577L	probably benign	Het
Vwa3b	A	C	1: 37,157,430	Q46P	probably damaging	Het
Wdr25	T	A	12: 108,992,799		probably null	Het
Wrap53	A	G	11: 69,562,400	L405P	probably damaging	Het
Zfp629	C	A	7: 127,611,989	W216L	probably damaging	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTCTGTTGCTGAAACCAATCC -3'
(R):5'- TGTTCTGTTCGTGCTACAACTGAGG -3'

Sequencing Primer
(F):5'- CTAGTACAGAAACTTCGGTGGTC -3'
(R):5'- GCTACAACTGAGGCTGTACTTTC -3'

Posted On

2014-01-05