Incidental Mutation 'R1061:Olfr484'
ID 94477
Institutional Source Beutler Lab
Gene Symbol Olfr484
Ensembl Gene ENSMUSG00000110171
Gene Name olfactory receptor 484
Synonyms MOR204-16, GA_x6K02T2PBJ9-10454128-10453163
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 108120691-108127449 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108124456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 269 (Y269C)
Ref Sequence ENSEMBL: ENSMUSP00000150774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210881] [ENSMUST00000214722]
AlphaFold Q8VFD3
Predicted Effect probably damaging
Transcript: ENSMUST00000073580
AA Change: Y269C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073267
Gene: ENSMUSG00000059996
AA Change: Y269C

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-53 PFAM
Pfam:7tm_1 44 293 4.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157612
Predicted Effect probably damaging
Transcript: ENSMUST00000210881
AA Change: Y269C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214722
AA Change: Y269C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Olfr484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr484 APN 7 108125164 missense possibly damaging 0.88
IGL01899:Olfr484 APN 7 108124841 missense probably benign 0.01
IGL02124:Olfr484 APN 7 108125042 missense probably benign 0.01
IGL02622:Olfr484 APN 7 108124388 missense probably damaging 1.00
IGL03188:Olfr484 APN 7 108124634 missense probably benign 0.00
R0389:Olfr484 UTSW 7 108124816 missense probably benign 0.00
R0443:Olfr484 UTSW 7 108124816 missense probably benign 0.00
R0731:Olfr484 UTSW 7 108124734 missense probably benign 0.12
R1505:Olfr484 UTSW 7 108124993 missense probably benign 0.00
R1591:Olfr484 UTSW 7 108124364 missense possibly damaging 0.56
R1789:Olfr484 UTSW 7 108124915 missense probably benign 0.44
R2988:Olfr484 UTSW 7 108124838 nonsense probably null
R4778:Olfr484 UTSW 7 108124480 missense possibly damaging 0.95
R5288:Olfr484 UTSW 7 108125168 missense probably benign 0.00
R5644:Olfr484 UTSW 7 108124651 missense probably benign 0.04
R6112:Olfr484 UTSW 7 108125162 missense probably benign 0.01
R6351:Olfr484 UTSW 7 108124430 missense probably damaging 1.00
R6934:Olfr484 UTSW 7 108124819 missense probably benign 0.14
R7094:Olfr484 UTSW 7 108124633 missense probably benign 0.35
R7135:Olfr484 UTSW 7 108124574 missense probably damaging 0.99
R7422:Olfr484 UTSW 7 108124861 missense probably damaging 1.00
R7660:Olfr484 UTSW 7 108124834 missense probably benign 0.04
R7916:Olfr484 UTSW 7 108125122 missense possibly damaging 0.59
R8489:Olfr484 UTSW 7 108125165 missense probably benign 0.03
R9204:Olfr484 UTSW 7 108124728 missense possibly damaging 0.75
X0021:Olfr484 UTSW 7 108125107 missense probably damaging 1.00
X0025:Olfr484 UTSW 7 108124399 nonsense probably null
Z1176:Olfr484 UTSW 7 108124879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGATAGCTACGAATACTGGGAGT -3'
(R):5'- TGTAGCGATCTGCAACCCACTG -3'

Sequencing Primer
(F):5'- AGTCCCACTGTCTTGAGTAATTGTC -3'
(R):5'- GGCACAGTTACTATGCTAACAGTG -3'
Posted On 2014-01-05