Mutagenetix > Incidental Mutation

Incidental Mutation 'F5770:Dnah12'

178025

Institutional Source

Beutler Lab

Gene Symbol

Dnah12

Ensembl Gene

ENSMUSG00000021879

Gene Name

dynein, axonemal, heavy chain 12

Synonyms

DHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

F5770 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26693274-26891703 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26773093 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1369 (N1369K)

Ref Sequence

ENSEMBL: ENSMUSP00000022433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022433] [ENSMUST00000073309]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022433
AA Change: N1369K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: N1369K

Domain	Start	End	E-Value	Type
low complexity region	127	140	N/A	INTRINSIC
coiled coil region	588	666	N/A	INTRINSIC
Pfam:DHC_N2	676	1113	1.1e-147	PFAM
AAA	1268	1407	1.15e0	SMART
Pfam:AAA_5	1552	1695	1.5e-7	PFAM
Blast:AAA	1709	1827	2e-24	BLAST
Blast:AAA	1848	1898	1e-16	BLAST
AAA	1903	2051	5.42e-4	SMART
Pfam:AAA_8	2238	2316	2e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000073309
AA Change: N120K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000073035
Gene: ENSMUSG00000021879
AA Change: N120K

Domain	Start	End	E-Value	Type
Pfam:AAA_6	1	203	4e-84	PFAM

Meta Mutation Damage Score

0.0972

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

99% (96/97)

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	A	T	4: 122,701,257	H102L	possibly damaging	Het
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
AC139131.1	T	G	7: 12,481,196		probably benign	Het
Ahcy	G	A	2: 155,064,921	R151*	probably null	Het
Arhgef38	T	G	3: 133,149,540	H262P	probably damaging	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Camk2g	T	C	14: 20,739,312		probably benign	Het
Casp8ap2	C	T	4: 32,639,944	H333Y	probably benign	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cdc42bpb	C	T	12: 111,296,391	G1501S	probably benign	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
Clasp1	G	A	1: 118,581,348	R1027Q	probably damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dcaf4	C	A	12: 83,537,701		probably null	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Dpyd	C	T	3: 118,897,126	Q295*	probably null	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Fbrsl1	C	T	5: 110,379,426	A129T	possibly damaging	Het
Fcgr1	T	C	3: 96,284,276	*405W	probably null	Het
Gdap1l1	C	T	2: 163,447,486		probably benign	Het
Glrx3	A	G	7: 137,459,153	H172R	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm20517	G	A	17: 47,618,832	V65M	probably damaging	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Golga4	A	G	9: 118,556,075	E727G	possibly damaging	Het
Got1	T	A	19: 43,500,561		probably benign	Het
Heatr5a	A	G	12: 51,881,278		probably benign	Het
Hira	G	A	16: 18,894,821	A29T	probably damaging	Het
Hnrnpab	A	T	11: 51,602,624	N252K	probably benign	Het
Ing1	T	C	8: 11,561,934	V124A	probably damaging	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Mbd5	A	G	2: 49,316,410	D1713G	probably damaging	Het
Mctp2	T	A	7: 72,121,751		probably benign	Het
Muc6	T	G	7: 141,647,613	E808A	probably benign	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Myrfl	T	C	10: 116,861,530	T30A	probably damaging	Het
Nbeal2	A	G	9: 110,637,937	V670A	possibly damaging	Het
Nphp3	T	C	9: 104,035,894		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Olfr480	G	T	7: 108,066,678	T40K	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Prkcb	G	T	7: 122,528,476	W274C	probably damaging	Het
Rabep1	T	C	11: 70,937,516		probably benign	Het
Ralgapa1	G	A	12: 55,795,653		probably benign	Het
Rasa1	A	G	13: 85,226,945		probably null	Het
Rbbp8nl	T	A	2: 180,278,208	T558S	probably benign	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Rundc3b	TGCCGCCGCCGCCGCCGCCGCCGCCGC	TGCCGCCGCCGCCGCCGCCGCCGC	5: 8,622,549		probably benign	Het
Sirpb1b	A	G	3: 15,503,183	V366A	probably benign	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Slc5a6	C	T	5: 31,042,613		probably null	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Thbd	A	T	2: 148,407,190	Y253N	probably benign	Het
Tiam1	C	T	16: 89,865,271	R653H	probably damaging	Het
Tmc3	T	C	7: 83,622,505	V955A	probably benign	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Toe1	A	T	4: 116,806,111	N56K	probably damaging	Het
Tprkb	A	G	6: 85,928,782	K150E	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Ttc23	T	C	7: 67,709,315		probably benign	Het
Ttc36	A	T	9: 44,801,797		probably benign	Het
Tubb3	C	T	8: 123,411,675		probably benign	Het
Vmn2r68	C	T	7: 85,221,880	V732I	probably benign	Het
Vps18	A	G	2: 119,297,228	Y844C	probably benign	Het
Wdr60	A	C	12: 116,211,840	S906A	possibly damaging	Het
Wdr72	T	A	9: 74,157,270	I528N	probably damaging	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zfp933	G	A	4: 147,826,470	A223V	probably damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Dnah12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Dnah12	APN	14	26771005	missense	probably damaging	1.00
IGL01602:Dnah12	APN	14	26710275	splice site	probably benign
IGL01681:Dnah12	APN	14	26722160	missense	probably benign
IGL02082:Dnah12	APN	14	26707162	missense	possibly damaging	0.79
IGL02140:Dnah12	APN	14	26716577	missense	probably benign	0.20
IGL02170:Dnah12	APN	14	26773112	missense	probably damaging	0.99
IGL02174:Dnah12	APN	14	26706917	missense	probably benign	0.00
IGL02367:Dnah12	APN	14	26709161	missense	probably benign	0.30
IGL02418:Dnah12	APN	14	26773722	missense	probably damaging	1.00
IGL03039:Dnah12	APN	14	26724512	missense	probably benign	0.02
IGL03066:Dnah12	APN	14	26697398	missense	probably benign	0.06
drippings	UTSW	14	26854804	missense	probably damaging	1.00
grueben	UTSW	14	26878079	missense	probably damaging	1.00
BB010:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
BB020:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
FR4304:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4340:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4342:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4589:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
IGL03055:Dnah12	UTSW	14	26872740	missense	probably damaging	1.00
LCD18:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
R0003:Dnah12	UTSW	14	26772644	missense	probably damaging	1.00
R0110:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0302:Dnah12	UTSW	14	26799999	missense	probably damaging	1.00
R0355:Dnah12	UTSW	14	26706117	splice site	probably null
R0364:Dnah12	UTSW	14	26724473	missense	probably benign	0.10
R0469:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0558:Dnah12	UTSW	14	26709310	missense	probably benign	0.00
R0709:Dnah12	UTSW	14	26884265	splice site	probably benign
R0734:Dnah12	UTSW	14	26800013	missense	probably benign	0.00
R1273:Dnah12	UTSW	14	26739220	nonsense	probably null
R1496:Dnah12	UTSW	14	26710248	missense	probably benign
R1503:Dnah12	UTSW	14	26773692	missense	probably damaging	1.00
R1535:Dnah12	UTSW	14	26816322	missense	possibly damaging	0.91
R1608:Dnah12	UTSW	14	26766190	missense	probably damaging	1.00
R1682:Dnah12	UTSW	14	26778883	missense	possibly damaging	0.71
R1758:Dnah12	UTSW	14	26766114	missense	probably benign	0.02
R1826:Dnah12	UTSW	14	26711019	missense	probably benign	0.01
R1829:Dnah12	UTSW	14	26773023	missense	probably damaging	1.00
R1829:Dnah12	UTSW	14	26800075	missense	probably damaging	1.00
R1862:Dnah12	UTSW	14	26697398	missense	probably benign	0.06
R1862:Dnah12	UTSW	14	26709257	missense	probably benign	0.30
R1913:Dnah12	UTSW	14	26792264	splice site	probably null
R1933:Dnah12	UTSW	14	26734495	missense	probably damaging	0.98
R2006:Dnah12	UTSW	14	26814459	missense	possibly damaging	0.95
R2045:Dnah12	UTSW	14	26781528	missense	probably null	1.00
R2113:Dnah12	UTSW	14	26766141	missense	probably damaging	1.00
R2125:Dnah12	UTSW	14	26724458	nonsense	probably null
R2126:Dnah12	UTSW	14	26724458	nonsense	probably null
R2207:Dnah12	UTSW	14	26781787	missense	probably damaging	0.99
R2213:Dnah12	UTSW	14	26739330	missense	probably benign	0.06
R2511:Dnah12	UTSW	14	26769950	missense	possibly damaging	0.65
R2875:Dnah12	UTSW	14	26693470	missense	probably benign	0.04
R2875:Dnah12	UTSW	14	26876950	missense	probably benign	0.05
R3551:Dnah12	UTSW	14	26770972	missense	probably benign	0.01
R3713:Dnah12	UTSW	14	26812790	missense	probably benign
R3729:Dnah12	UTSW	14	26706065	missense	probably benign	0.02
R3799:Dnah12	UTSW	14	26770923	missense	probably damaging	1.00
R3846:Dnah12	UTSW	14	26710211	missense	probably benign	0.00
R3892:Dnah12	UTSW	14	26856616	missense	probably benign	0.03
R3921:Dnah12	UTSW	14	26771051	missense	probably damaging	1.00
R3940:Dnah12	UTSW	14	26723599	missense	probably benign
R4065:Dnah12	UTSW	14	26770448	missense	probably benign	0.02
R4113:Dnah12	UTSW	14	26693567	missense	probably damaging	0.98
R4249:Dnah12	UTSW	14	26709186	missense	possibly damaging	0.70
R4259:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4260:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4348:Dnah12	UTSW	14	26814541	missense	possibly damaging	0.94
R4457:Dnah12	UTSW	14	26815507	missense	probably damaging	1.00
R4490:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4491:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4494:Dnah12	UTSW	14	26871855	missense	probably damaging	0.99
R4523:Dnah12	UTSW	14	26770022	missense	probably damaging	0.97
R4523:Dnah12	UTSW	14	26876958	missense	possibly damaging	0.83
R4546:Dnah12	UTSW	14	26773014	missense	probably damaging	1.00
R4584:Dnah12	UTSW	14	26772594	missense	probably damaging	1.00
R4624:Dnah12	UTSW	14	26735758	missense	possibly damaging	0.82
R4689:Dnah12	UTSW	14	26706839	missense	probably benign	0.00
R4727:Dnah12	UTSW	14	26872317	missense	probably damaging	1.00
R4732:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4733:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4851:Dnah12	UTSW	14	26716629	nonsense	probably null
R4879:Dnah12	UTSW	14	26718046	critical splice donor site	probably null
R4893:Dnah12	UTSW	14	26710170	missense	possibly damaging	0.66
R4915:Dnah12	UTSW	14	26734570	missense	probably damaging	1.00
R4927:Dnah12	UTSW	14	26861805	nonsense	probably null
R4939:Dnah12	UTSW	14	26891524	missense	probably damaging	1.00
R4962:Dnah12	UTSW	14	26716700	missense	probably benign	0.00
R5011:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5013:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5043:Dnah12	UTSW	14	26884190	missense	probably damaging	1.00
R5049:Dnah12	UTSW	14	26735697	missense	probably benign	0.09
R5122:Dnah12	UTSW	14	26718000	missense	probably benign	0.00
R5135:Dnah12	UTSW	14	26770477	missense	probably damaging	0.99
R5149:Dnah12	UTSW	14	26850926	nonsense	probably null
R5154:Dnah12	UTSW	14	26849363	missense	probably benign	0.12
R5206:Dnah12	UTSW	14	26769985	missense	probably damaging	1.00
R5307:Dnah12	UTSW	14	26693486	missense	possibly damaging	0.49
R5330:Dnah12	UTSW	14	26773830	missense	probably damaging	1.00
R5335:Dnah12	UTSW	14	26879738	missense	probably damaging	1.00
R5339:Dnah12	UTSW	14	26814537	missense	possibly damaging	0.83
R5354:Dnah12	UTSW	14	26774342	splice site	probably null
R5389:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R5434:Dnah12	UTSW	14	26859299	missense	probably damaging	1.00
R5466:Dnah12	UTSW	14	26771050	missense	probably damaging	1.00
R5655:Dnah12	UTSW	14	26710269	missense	probably benign	0.01
R5681:Dnah12	UTSW	14	26815495	missense	probably benign	0.32
R5824:Dnah12	UTSW	14	26770518	critical splice donor site	probably null
R5863:Dnah12	UTSW	14	26854921	missense	probably damaging	1.00
R5890:Dnah12	UTSW	14	26706884	missense	probably benign	0.09
R5912:Dnah12	UTSW	14	26770008	nonsense	probably null
R5916:Dnah12	UTSW	14	26706918	missense	possibly damaging	0.92
R5941:Dnah12	UTSW	14	26706867	missense	probably benign	0.00
R5987:Dnah12	UTSW	14	26886871	missense	possibly damaging	0.54
R5992:Dnah12	UTSW	14	26697341	missense	probably benign	0.04
R6132:Dnah12	UTSW	14	26717911	missense	probably damaging	1.00
R6136:Dnah12	UTSW	14	26875270	missense	probably damaging	0.99
R6158:Dnah12	UTSW	14	26773685	missense	possibly damaging	0.95
R6183:Dnah12	UTSW	14	26861769	missense	probably damaging	1.00
R6191:Dnah12	UTSW	14	26710257	missense	probably benign	0.03
R6235:Dnah12	UTSW	14	26854804	missense	probably damaging	1.00
R6277:Dnah12	UTSW	14	26770482	missense	probably damaging	1.00
R6332:Dnah12	UTSW	14	26717974	missense	probably damaging	0.99
R6334:Dnah12	UTSW	14	26706834	missense	possibly damaging	0.51
R6443:Dnah12	UTSW	14	26878051	missense	probably benign	0.06
R6480:Dnah12	UTSW	14	26872455	missense	probably damaging	1.00
R6530:Dnah12	UTSW	14	26735710	missense	probably damaging	1.00
R6678:Dnah12	UTSW	14	26735692	missense	probably damaging	1.00
R6709:Dnah12	UTSW	14	26872749	missense	probably damaging	1.00
R6724:Dnah12	UTSW	14	26796223	missense	probably benign	0.02
R6745:Dnah12	UTSW	14	26707228	missense	probably damaging	0.99
R6788:Dnah12	UTSW	14	26801513	missense	probably damaging	0.99
R6894:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R6912:Dnah12	UTSW	14	26878079	missense	probably damaging	1.00
R6982:Dnah12	UTSW	14	26799076	splice site	probably null
R7001:Dnah12	UTSW	14	26879724	missense	probably damaging	0.99
R7002:Dnah12	UTSW	14	26876998	missense	probably damaging	1.00
R7017:Dnah12	UTSW	14	26735680	missense	probably benign
R7107:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7108:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7121:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7122:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26801413	missense	probably damaging	0.99
R7150:Dnah12	UTSW	14	26861732	missense	probably damaging	0.99
R7188:Dnah12	UTSW	14	26814413	missense	probably benign	0.04
R7201:Dnah12	UTSW	14	26814622	missense	probably benign	0.08
R7202:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26781485	missense	probably damaging	0.99
R7205:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7206:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7219:Dnah12	UTSW	14	26854880	missense	probably damaging	0.99
R7337:Dnah12	UTSW	14	26766577	splice site	probably null
R7339:Dnah12	UTSW	14	26872320	missense	probably benign
R7363:Dnah12	UTSW	14	26724611	missense	probably benign
R7426:Dnah12	UTSW	14	26724626	missense	probably benign	0.01
R7472:Dnah12	UTSW	14	26856635	missense	probably benign	0.01
R7579:Dnah12	UTSW	14	26770503	missense	probably benign	0.05
R7655:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7656:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7694:Dnah12	UTSW	14	26781380	missense	probably damaging	1.00
R7730:Dnah12	UTSW	14	26785933	missense	probably damaging	1.00
R7837:Dnah12	UTSW	14	26796219	missense	probably benign	0.01
R7855:Dnah12	UTSW	14	26829329	missense	probably benign	0.14
R7870:Dnah12	UTSW	14	26856529	missense	probably benign	0.00
R7920:Dnah12	UTSW	14	26856542	missense	possibly damaging	0.58
R7933:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
R7956:Dnah12	UTSW	14	26709272	missense	probably damaging	0.96
R8192:Dnah12	UTSW	14	26706881	missense	probably benign
R8263:Dnah12	UTSW	14	26891464	missense	noncoding transcript
R8287:Dnah12	UTSW	14	26812603	missense	probably benign
R8336:Dnah12	UTSW	14	26711065	missense	probably benign	0.01
R8362:Dnah12	UTSW	14	26854831	missense	probably damaging	1.00
R8392:Dnah12	UTSW	14	26885912	missense	probably benign
R8458:Dnah12	UTSW	14	26826892	critical splice acceptor site	probably null
R8481:Dnah12	UTSW	14	26853796	missense	probably benign	0.02
R8551:Dnah12	UTSW	14	26774270	missense	probably damaging	0.97
R8669:Dnah12	UTSW	14	26830625	splice site	probably benign
R8698:Dnah12	UTSW	14	26707263	missense	probably benign	0.02
R8709:Dnah12	UTSW	14	26693602	missense	probably benign	0.00
R8778:Dnah12	UTSW	14	26734563	missense	probably benign	0.29
R9049:Dnah12	UTSW	14	26722120	missense	probably benign	0.00
R9087:Dnah12	UTSW	14	26824546	missense	probably damaging	1.00
R9099:Dnah12	UTSW	14	26770368	missense	probably benign	0.31
R9153:Dnah12	UTSW	14	26814612	missense	probably damaging	1.00
R9177:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9214:Dnah12	UTSW	14	26723905	missense	probably benign	0.02
R9268:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9274:Dnah12	UTSW	14	26815417	missense	probably benign	0.00
R9293:Dnah12	UTSW	14	26773059	missense	probably benign
R9322:Dnah12	UTSW	14	26770977	missense	possibly damaging	0.75
R9353:Dnah12	UTSW	14	26856550	missense	probably damaging	1.00
R9506:Dnah12	UTSW	14	26792211	missense	probably benign	0.00
R9518:Dnah12	UTSW	14	26773756	missense	probably damaging	1.00
R9524:Dnah12	UTSW	14	26850537	missense	probably null	0.91
R9562:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9565:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9573:Dnah12	UTSW	14	26693464	missense	probably benign
R9581:Dnah12	UTSW	14	26770028	missense	probably damaging	1.00
R9689:Dnah12	UTSW	14	26868914	missense	probably null	1.00
R9727:Dnah12	UTSW	14	26801553	nonsense	probably null
V7580:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
V7581:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
X0018:Dnah12	UTSW	14	26814480	missense	probably damaging	1.00
X0027:Dnah12	UTSW	14	26816288	missense	probably damaging	1.00
X0065:Dnah12	UTSW	14	26814645	missense	possibly damaging	0.93
Z1177:Dnah12	UTSW	14	26875215	missense	probably damaging	1.00

Predicted Primers

Posted On

2014-05-07