Incidental Mutation 'R5941:Dnah12'
ID460300
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 044133-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R5941 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26706867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 216 (E216G)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably benign
Transcript: ENSMUST00000022433
AA Change: E216G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: E216G

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,591,098 D70E probably damaging Het
Adamts14 C T 10: 61,221,895 G561R probably damaging Het
Alpk3 A T 7: 81,078,653 K510N probably damaging Het
Ap3b1 A G 13: 94,440,273 N269D probably benign Het
Ap3b1 T C 13: 94,483,265 S144P probably damaging Het
Apba2 C A 7: 64,745,716 Q635K probably benign Het
Aspg C T 12: 112,113,085 T99I probably benign Het
Atp7b A G 8: 21,997,496 V1179A probably damaging Het
Bbs12 T C 3: 37,320,048 V215A probably damaging Het
Bcl2l11 C A 2: 128,127,783 probably benign Het
Bglap3 T G 3: 88,376,346 probably benign Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cdh26 C T 2: 178,481,650 Q662* probably null Het
Cftr T A 6: 18,313,646 F1290I probably damaging Het
Clip3 G A 7: 30,292,306 E36K probably damaging Het
Cog2 A G 8: 124,546,086 I541V probably benign Het
Cpt1b A T 15: 89,425,214 W39R probably damaging Het
Csmd1 A G 8: 15,932,471 V2732A probably damaging Het
Dlec1 A G 9: 119,126,312 D688G probably damaging Het
Dnah7b C A 1: 46,187,290 L1294I probably damaging Het
Duox1 T A 2: 122,344,156 L1265Q probably damaging Het
Fam91a1 T A 15: 58,431,317 D358E probably benign Het
Fat3 A C 9: 15,999,501 I1735S probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabrr1 T A 4: 33,162,676 M414K probably benign Het
Gm21915 A C 9: 40,670,699 E29D possibly damaging Het
Gm340 G A 19: 41,586,400 R1198Q probably damaging Het
Gm9955 G A 18: 24,709,263 probably benign Het
Gpat2 C A 2: 127,428,275 D69E possibly damaging Het
Grin2b T G 6: 135,736,373 I837L probably damaging Het
Gucy2g T C 19: 55,215,131 D745G probably damaging Het
H2-Q1 A G 17: 35,321,356 Y139C probably damaging Het
Ints2 G C 11: 86,250,972 N216K probably benign Het
Jmy G A 13: 93,498,825 P161L probably benign Het
Kctd11 G A 11: 69,879,973 R80W possibly damaging Het
Kif7 A G 7: 79,711,132 probably benign Het
Kifc1 C T 17: 33,883,085 probably benign Het
Mir412 C A 12: 109,743,299 noncoding transcript Het
Mknk1 T A 4: 115,876,637 probably benign Het
Mmp16 A G 4: 18,054,354 probably benign Het
Mmp7 A G 9: 7,697,645 H227R probably damaging Het
Myh4 A C 11: 67,259,300 D1861A probably damaging Het
Nup205 T C 6: 35,232,408 L1550P probably damaging Het
Olfr1218 T A 2: 89,054,619 H269L probably benign Het
Olfr1510 C T 14: 52,410,068 G268D probably benign Het
Olfr444 G T 6: 42,955,716 A73S possibly damaging Het
Olfr48 T A 2: 89,844,515 I153F probably benign Het
Olfr609 A G 7: 103,492,720 S53P possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pafah1b2 A T 9: 45,976,107 C35* probably null Het
Pappa T A 4: 65,314,593 F1323Y possibly damaging Het
Phtf2 A T 5: 20,774,073 F519Y probably damaging Het
Pigk T C 3: 152,766,513 I354T possibly damaging Het
Plekha7 T C 7: 116,124,805 D1265G possibly damaging Het
Prss12 A G 3: 123,505,501 R641G probably benign Het
Prss28 A G 17: 25,309,743 Y53C probably damaging Het
Rabgap1 G T 2: 37,561,896 C936F possibly damaging Het
Rap1a T C 3: 105,732,069 I91M possibly damaging Het
Rap1gap2 A T 11: 74,392,237 M679K probably damaging Het
Rapgef5 T A 12: 117,728,738 L352I probably damaging Het
Rhbdl3 G A 11: 80,331,889 V255M probably benign Het
Rhot1 T C 11: 80,251,170 probably benign Het
Rita1 A C 5: 120,609,561 V224G probably benign Het
Ryr2 T A 13: 11,687,902 Y2900F probably damaging Het
Scaf11 A C 15: 96,420,308 H458Q probably damaging Het
Scamp4 T A 10: 80,612,421 S159T probably benign Het
Setd5 T A 6: 113,128,490 Y828N probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Sipa1l2 A G 8: 125,473,536 S684P probably damaging Het
Stard9 A T 2: 120,713,558 I4446F probably damaging Het
Sult1c2 T C 17: 53,831,898 D217G probably benign Het
Supt16 C A 14: 52,182,196 K148N probably benign Het
Syne3 G A 12: 104,946,992 S570L probably benign Het
Tcf3 G T 10: 80,413,044 D534E probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trbv3 T C 6: 41,048,401 I3T probably benign Het
Trbv4 T A 6: 41,059,629 Y29* probably null Het
Ttl A G 2: 129,075,984 N122S probably benign Het
Txndc11 T C 16: 11,075,071 T932A probably benign Het
Ube2e2 G A 14: 18,586,910 A150V probably damaging Het
Ube2ql1 T C 13: 69,739,340 M1V probably null Het
Uqcrc1 A G 9: 108,947,486 probably benign Het
Utrn T C 10: 12,486,483 D2702G probably damaging Het
Vcan T A 13: 89,692,691 D618V probably damaging Het
Vdac3-ps1 A G 13: 18,031,202 noncoding transcript Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zap70 G A 1: 36,770,949 V47M probably damaging Het
Zfp770 A G 2: 114,197,546 M14T possibly damaging Het
Zufsp C T 10: 33,949,462 G8D probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7472:Dnah12 UTSW 14 26856635 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCAGTTTCAAAACCGAGTGC -3'
(R):5'- ACAATCAATTGGGCCTCTAGC -3'

Sequencing Primer
(F):5'- GTTTCAAAACCGAGTGCTTACAC -3'
(R):5'- GGCCTCTAGCTCTATTGATGAAC -3'
Posted On2017-02-28