Mutagenetix > Incidental Mutation

Incidental Mutation 'R5941:Dnah12'

460300

Institutional Source

Beutler Lab

Gene Symbol

Dnah12

Ensembl Gene

ENSMUSG00000021879

Gene Name

dynein, axonemal, heavy chain 12

Synonyms

DHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12

MMRRC Submission

044133-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.174) question?

Stock #

R5941 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26693274-26891703 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26706867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 216 (E216G)

Ref Sequence

ENSEMBL: ENSMUSP00000022433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022433]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000022433
AA Change: E216G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: E216G

Domain	Start	End	E-Value	Type
low complexity region	127	140	N/A	INTRINSIC
coiled coil region	588	666	N/A	INTRINSIC
Pfam:DHC_N2	676	1113	1.1e-147	PFAM
AAA	1268	1407	1.15e0	SMART
Pfam:AAA_5	1552	1695	1.5e-7	PFAM
Blast:AAA	1709	1827	2e-24	BLAST
Blast:AAA	1848	1898	1e-16	BLAST
AAA	1903	2051	5.42e-4	SMART
Pfam:AAA_8	2238	2316	2e-18	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.2%

Validation Efficiency

97% (95/98)

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	A	7: 119,591,098	D70E	probably damaging	Het
Adamts14	C	T	10: 61,221,895	G561R	probably damaging	Het
Alpk3	A	T	7: 81,078,653	K510N	probably damaging	Het
Ap3b1	A	G	13: 94,440,273	N269D	probably benign	Het
Ap3b1	T	C	13: 94,483,265	S144P	probably damaging	Het
Apba2	C	A	7: 64,745,716	Q635K	probably benign	Het
Aspg	C	T	12: 112,113,085	T99I	probably benign	Het
Atp7b	A	G	8: 21,997,496	V1179A	probably damaging	Het
Bbs12	T	C	3: 37,320,048	V215A	probably damaging	Het
Bcl2l11	C	A	2: 128,127,783		probably benign	Het
Bglap3	T	G	3: 88,376,346		probably benign	Het
Cchcr1	G	A	17: 35,524,993	R284Q	probably damaging	Het
Cdh26	C	T	2: 178,481,650	Q662*	probably null	Het
Cftr	T	A	6: 18,313,646	F1290I	probably damaging	Het
Clip3	G	A	7: 30,292,306	E36K	probably damaging	Het
Cog2	A	G	8: 124,546,086	I541V	probably benign	Het
Cpt1b	A	T	15: 89,425,214	W39R	probably damaging	Het
Csmd1	A	G	8: 15,932,471	V2732A	probably damaging	Het
Dlec1	A	G	9: 119,126,312	D688G	probably damaging	Het
Dnah7b	C	A	1: 46,187,290	L1294I	probably damaging	Het
Duox1	T	A	2: 122,344,156	L1265Q	probably damaging	Het
Fam91a1	T	A	15: 58,431,317	D358E	probably benign	Het
Fat3	A	C	9: 15,999,501	I1735S	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Gabrr1	T	A	4: 33,162,676	M414K	probably benign	Het
Gm21915	A	C	9: 40,670,699	E29D	possibly damaging	Het
Gm340	G	A	19: 41,586,400	R1198Q	probably damaging	Het
Gm9955	G	A	18: 24,709,263		probably benign	Het
Gpat2	C	A	2: 127,428,275	D69E	possibly damaging	Het
Grin2b	T	G	6: 135,736,373	I837L	probably damaging	Het
Gucy2g	T	C	19: 55,215,131	D745G	probably damaging	Het
H2-Q1	A	G	17: 35,321,356	Y139C	probably damaging	Het
Ints2	G	C	11: 86,250,972	N216K	probably benign	Het
Jmy	G	A	13: 93,498,825	P161L	probably benign	Het
Kctd11	G	A	11: 69,879,973	R80W	possibly damaging	Het
Kif7	A	G	7: 79,711,132		probably benign	Het
Kifc1	C	T	17: 33,883,085		probably benign	Het
Mir412	C	A	12: 109,743,299		noncoding transcript	Het
Mknk1	T	A	4: 115,876,637		probably benign	Het
Mmp16	A	G	4: 18,054,354		probably benign	Het
Mmp7	A	G	9: 7,697,645	H227R	probably damaging	Het
Myh4	A	C	11: 67,259,300	D1861A	probably damaging	Het
Nup205	T	C	6: 35,232,408	L1550P	probably damaging	Het
Olfr1218	T	A	2: 89,054,619	H269L	probably benign	Het
Olfr1510	C	T	14: 52,410,068	G268D	probably benign	Het
Olfr444	G	T	6: 42,955,716	A73S	possibly damaging	Het
Olfr48	T	A	2: 89,844,515	I153F	probably benign	Het
Olfr609	A	G	7: 103,492,720	S53P	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pafah1b2	A	T	9: 45,976,107	C35*	probably null	Het
Pappa	T	A	4: 65,314,593	F1323Y	possibly damaging	Het
Phtf2	A	T	5: 20,774,073	F519Y	probably damaging	Het
Pigk	T	C	3: 152,766,513	I354T	possibly damaging	Het
Plekha7	T	C	7: 116,124,805	D1265G	possibly damaging	Het
Prss12	A	G	3: 123,505,501	R641G	probably benign	Het
Prss28	A	G	17: 25,309,743	Y53C	probably damaging	Het
Rabgap1	G	T	2: 37,561,896	C936F	possibly damaging	Het
Rap1a	T	C	3: 105,732,069	I91M	possibly damaging	Het
Rap1gap2	A	T	11: 74,392,237	M679K	probably damaging	Het
Rapgef5	T	A	12: 117,728,738	L352I	probably damaging	Het
Rhbdl3	G	A	11: 80,331,889	V255M	probably benign	Het
Rhot1	T	C	11: 80,251,170		probably benign	Het
Rita1	A	C	5: 120,609,561	V224G	probably benign	Het
Ryr2	T	A	13: 11,687,902	Y2900F	probably damaging	Het
Scaf11	A	C	15: 96,420,308	H458Q	probably damaging	Het
Scamp4	T	A	10: 80,612,421	S159T	probably benign	Het
Setd5	T	A	6: 113,128,490	Y828N	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Sipa1l2	A	G	8: 125,473,536	S684P	probably damaging	Het
Stard9	A	T	2: 120,713,558	I4446F	probably damaging	Het
Sult1c2	T	C	17: 53,831,898	D217G	probably benign	Het
Supt16	C	A	14: 52,182,196	K148N	probably benign	Het
Syne3	G	A	12: 104,946,992	S570L	probably benign	Het
Tcf3	G	T	10: 80,413,044	D534E	probably benign	Het
Tmed6	G	T	8: 107,064,154	T87K	probably damaging	Het
Trbv3	T	C	6: 41,048,401	I3T	probably benign	Het
Trbv4	T	A	6: 41,059,629	Y29*	probably null	Het
Ttl	A	G	2: 129,075,984	N122S	probably benign	Het
Txndc11	T	C	16: 11,075,071	T932A	probably benign	Het
Ube2e2	G	A	14: 18,586,910	A150V	probably damaging	Het
Ube2ql1	T	C	13: 69,739,340	M1V	probably null	Het
Uqcrc1	A	G	9: 108,947,486		probably benign	Het
Utrn	T	C	10: 12,486,483	D2702G	probably damaging	Het
Vcan	T	A	13: 89,692,691	D618V	probably damaging	Het
Vdac3-ps1	A	G	13: 18,031,202		noncoding transcript	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Zap70	G	A	1: 36,770,949	V47M	probably damaging	Het
Zfp770	A	G	2: 114,197,546	M14T	possibly damaging	Het
Zufsp	C	T	10: 33,949,462	G8D	probably damaging	Het

Other mutations in Dnah12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Dnah12	APN	14	26771005	missense	probably damaging	1.00
IGL01602:Dnah12	APN	14	26710275	splice site	probably benign
IGL01681:Dnah12	APN	14	26722160	missense	probably benign
IGL02082:Dnah12	APN	14	26707162	missense	possibly damaging	0.79
IGL02140:Dnah12	APN	14	26716577	missense	probably benign	0.20
IGL02170:Dnah12	APN	14	26773112	missense	probably damaging	0.99
IGL02174:Dnah12	APN	14	26706917	missense	probably benign	0.00
IGL02367:Dnah12	APN	14	26709161	missense	probably benign	0.30
IGL02418:Dnah12	APN	14	26773722	missense	probably damaging	1.00
IGL03039:Dnah12	APN	14	26724512	missense	probably benign	0.02
IGL03066:Dnah12	APN	14	26697398	missense	probably benign	0.06
drippings	UTSW	14	26854804	missense	probably damaging	1.00
grueben	UTSW	14	26878079	missense	probably damaging	1.00
BB010:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
BB020:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
F5770:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
FR4304:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4340:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4342:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4589:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
IGL03055:Dnah12	UTSW	14	26872740	missense	probably damaging	1.00
LCD18:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
R0003:Dnah12	UTSW	14	26772644	missense	probably damaging	1.00
R0110:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0302:Dnah12	UTSW	14	26799999	missense	probably damaging	1.00
R0355:Dnah12	UTSW	14	26706117	splice site	probably null
R0364:Dnah12	UTSW	14	26724473	missense	probably benign	0.10
R0469:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0558:Dnah12	UTSW	14	26709310	missense	probably benign	0.00
R0709:Dnah12	UTSW	14	26884265	splice site	probably benign
R0734:Dnah12	UTSW	14	26800013	missense	probably benign	0.00
R1273:Dnah12	UTSW	14	26739220	nonsense	probably null
R1496:Dnah12	UTSW	14	26710248	missense	probably benign
R1503:Dnah12	UTSW	14	26773692	missense	probably damaging	1.00
R1535:Dnah12	UTSW	14	26816322	missense	possibly damaging	0.91
R1608:Dnah12	UTSW	14	26766190	missense	probably damaging	1.00
R1682:Dnah12	UTSW	14	26778883	missense	possibly damaging	0.71
R1758:Dnah12	UTSW	14	26766114	missense	probably benign	0.02
R1826:Dnah12	UTSW	14	26711019	missense	probably benign	0.01
R1829:Dnah12	UTSW	14	26773023	missense	probably damaging	1.00
R1829:Dnah12	UTSW	14	26800075	missense	probably damaging	1.00
R1862:Dnah12	UTSW	14	26697398	missense	probably benign	0.06
R1862:Dnah12	UTSW	14	26709257	missense	probably benign	0.30
R1913:Dnah12	UTSW	14	26792264	splice site	probably null
R1933:Dnah12	UTSW	14	26734495	missense	probably damaging	0.98
R2006:Dnah12	UTSW	14	26814459	missense	possibly damaging	0.95
R2045:Dnah12	UTSW	14	26781528	missense	probably null	1.00
R2113:Dnah12	UTSW	14	26766141	missense	probably damaging	1.00
R2125:Dnah12	UTSW	14	26724458	nonsense	probably null
R2126:Dnah12	UTSW	14	26724458	nonsense	probably null
R2207:Dnah12	UTSW	14	26781787	missense	probably damaging	0.99
R2213:Dnah12	UTSW	14	26739330	missense	probably benign	0.06
R2511:Dnah12	UTSW	14	26769950	missense	possibly damaging	0.65
R2875:Dnah12	UTSW	14	26693470	missense	probably benign	0.04
R2875:Dnah12	UTSW	14	26876950	missense	probably benign	0.05
R3551:Dnah12	UTSW	14	26770972	missense	probably benign	0.01
R3713:Dnah12	UTSW	14	26812790	missense	probably benign
R3729:Dnah12	UTSW	14	26706065	missense	probably benign	0.02
R3799:Dnah12	UTSW	14	26770923	missense	probably damaging	1.00
R3846:Dnah12	UTSW	14	26710211	missense	probably benign	0.00
R3892:Dnah12	UTSW	14	26856616	missense	probably benign	0.03
R3921:Dnah12	UTSW	14	26771051	missense	probably damaging	1.00
R3940:Dnah12	UTSW	14	26723599	missense	probably benign
R4065:Dnah12	UTSW	14	26770448	missense	probably benign	0.02
R4113:Dnah12	UTSW	14	26693567	missense	probably damaging	0.98
R4249:Dnah12	UTSW	14	26709186	missense	possibly damaging	0.70
R4259:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4260:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4348:Dnah12	UTSW	14	26814541	missense	possibly damaging	0.94
R4457:Dnah12	UTSW	14	26815507	missense	probably damaging	1.00
R4490:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4491:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4494:Dnah12	UTSW	14	26871855	missense	probably damaging	0.99
R4523:Dnah12	UTSW	14	26770022	missense	probably damaging	0.97
R4523:Dnah12	UTSW	14	26876958	missense	possibly damaging	0.83
R4546:Dnah12	UTSW	14	26773014	missense	probably damaging	1.00
R4584:Dnah12	UTSW	14	26772594	missense	probably damaging	1.00
R4624:Dnah12	UTSW	14	26735758	missense	possibly damaging	0.82
R4689:Dnah12	UTSW	14	26706839	missense	probably benign	0.00
R4727:Dnah12	UTSW	14	26872317	missense	probably damaging	1.00
R4732:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4733:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4851:Dnah12	UTSW	14	26716629	nonsense	probably null
R4879:Dnah12	UTSW	14	26718046	critical splice donor site	probably null
R4893:Dnah12	UTSW	14	26710170	missense	possibly damaging	0.66
R4915:Dnah12	UTSW	14	26734570	missense	probably damaging	1.00
R4927:Dnah12	UTSW	14	26861805	nonsense	probably null
R4939:Dnah12	UTSW	14	26891524	missense	probably damaging	1.00
R4962:Dnah12	UTSW	14	26716700	missense	probably benign	0.00
R5011:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5013:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5043:Dnah12	UTSW	14	26884190	missense	probably damaging	1.00
R5049:Dnah12	UTSW	14	26735697	missense	probably benign	0.09
R5122:Dnah12	UTSW	14	26718000	missense	probably benign	0.00
R5135:Dnah12	UTSW	14	26770477	missense	probably damaging	0.99
R5149:Dnah12	UTSW	14	26850926	nonsense	probably null
R5154:Dnah12	UTSW	14	26849363	missense	probably benign	0.12
R5206:Dnah12	UTSW	14	26769985	missense	probably damaging	1.00
R5307:Dnah12	UTSW	14	26693486	missense	possibly damaging	0.49
R5330:Dnah12	UTSW	14	26773830	missense	probably damaging	1.00
R5335:Dnah12	UTSW	14	26879738	missense	probably damaging	1.00
R5339:Dnah12	UTSW	14	26814537	missense	possibly damaging	0.83
R5354:Dnah12	UTSW	14	26774342	splice site	probably null
R5389:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R5434:Dnah12	UTSW	14	26859299	missense	probably damaging	1.00
R5466:Dnah12	UTSW	14	26771050	missense	probably damaging	1.00
R5655:Dnah12	UTSW	14	26710269	missense	probably benign	0.01
R5681:Dnah12	UTSW	14	26815495	missense	probably benign	0.32
R5824:Dnah12	UTSW	14	26770518	critical splice donor site	probably null
R5863:Dnah12	UTSW	14	26854921	missense	probably damaging	1.00
R5890:Dnah12	UTSW	14	26706884	missense	probably benign	0.09
R5912:Dnah12	UTSW	14	26770008	nonsense	probably null
R5916:Dnah12	UTSW	14	26706918	missense	possibly damaging	0.92
R5987:Dnah12	UTSW	14	26886871	missense	possibly damaging	0.54
R5992:Dnah12	UTSW	14	26697341	missense	probably benign	0.04
R6132:Dnah12	UTSW	14	26717911	missense	probably damaging	1.00
R6136:Dnah12	UTSW	14	26875270	missense	probably damaging	0.99
R6158:Dnah12	UTSW	14	26773685	missense	possibly damaging	0.95
R6183:Dnah12	UTSW	14	26861769	missense	probably damaging	1.00
R6191:Dnah12	UTSW	14	26710257	missense	probably benign	0.03
R6235:Dnah12	UTSW	14	26854804	missense	probably damaging	1.00
R6277:Dnah12	UTSW	14	26770482	missense	probably damaging	1.00
R6332:Dnah12	UTSW	14	26717974	missense	probably damaging	0.99
R6334:Dnah12	UTSW	14	26706834	missense	possibly damaging	0.51
R6443:Dnah12	UTSW	14	26878051	missense	probably benign	0.06
R6480:Dnah12	UTSW	14	26872455	missense	probably damaging	1.00
R6530:Dnah12	UTSW	14	26735710	missense	probably damaging	1.00
R6678:Dnah12	UTSW	14	26735692	missense	probably damaging	1.00
R6709:Dnah12	UTSW	14	26872749	missense	probably damaging	1.00
R6724:Dnah12	UTSW	14	26796223	missense	probably benign	0.02
R6745:Dnah12	UTSW	14	26707228	missense	probably damaging	0.99
R6788:Dnah12	UTSW	14	26801513	missense	probably damaging	0.99
R6894:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R6912:Dnah12	UTSW	14	26878079	missense	probably damaging	1.00
R6982:Dnah12	UTSW	14	26799076	splice site	probably null
R7001:Dnah12	UTSW	14	26879724	missense	probably damaging	0.99
R7002:Dnah12	UTSW	14	26876998	missense	probably damaging	1.00
R7017:Dnah12	UTSW	14	26735680	missense	probably benign
R7107:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7108:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7121:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7122:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26801413	missense	probably damaging	0.99
R7150:Dnah12	UTSW	14	26861732	missense	probably damaging	0.99
R7188:Dnah12	UTSW	14	26814413	missense	probably benign	0.04
R7201:Dnah12	UTSW	14	26814622	missense	probably benign	0.08
R7202:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26781485	missense	probably damaging	0.99
R7205:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7206:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7219:Dnah12	UTSW	14	26854880	missense	probably damaging	0.99
R7337:Dnah12	UTSW	14	26766577	splice site	probably null
R7339:Dnah12	UTSW	14	26872320	missense	probably benign
R7363:Dnah12	UTSW	14	26724611	missense	probably benign
R7426:Dnah12	UTSW	14	26724626	missense	probably benign	0.01
R7472:Dnah12	UTSW	14	26856635	missense	probably benign	0.01
R7579:Dnah12	UTSW	14	26770503	missense	probably benign	0.05
R7655:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7656:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7694:Dnah12	UTSW	14	26781380	missense	probably damaging	1.00
R7730:Dnah12	UTSW	14	26785933	missense	probably damaging	1.00
R7837:Dnah12	UTSW	14	26796219	missense	probably benign	0.01
R7855:Dnah12	UTSW	14	26829329	missense	probably benign	0.14
R7870:Dnah12	UTSW	14	26856529	missense	probably benign	0.00
R7920:Dnah12	UTSW	14	26856542	missense	possibly damaging	0.58
R7933:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
R7956:Dnah12	UTSW	14	26709272	missense	probably damaging	0.96
R8192:Dnah12	UTSW	14	26706881	missense	probably benign
R8263:Dnah12	UTSW	14	26891464	missense	noncoding transcript
R8287:Dnah12	UTSW	14	26812603	missense	probably benign
R8336:Dnah12	UTSW	14	26711065	missense	probably benign	0.01
R8362:Dnah12	UTSW	14	26854831	missense	probably damaging	1.00
R8392:Dnah12	UTSW	14	26885912	missense	probably benign
R8458:Dnah12	UTSW	14	26826892	critical splice acceptor site	probably null
R8481:Dnah12	UTSW	14	26853796	missense	probably benign	0.02
R8551:Dnah12	UTSW	14	26774270	missense	probably damaging	0.97
R8669:Dnah12	UTSW	14	26830625	splice site	probably benign
R8698:Dnah12	UTSW	14	26707263	missense	probably benign	0.02
R8709:Dnah12	UTSW	14	26693602	missense	probably benign	0.00
R8778:Dnah12	UTSW	14	26734563	missense	probably benign	0.29
R9049:Dnah12	UTSW	14	26722120	missense	probably benign	0.00
R9087:Dnah12	UTSW	14	26824546	missense	probably damaging	1.00
R9099:Dnah12	UTSW	14	26770368	missense	probably benign	0.31
R9153:Dnah12	UTSW	14	26814612	missense	probably damaging	1.00
R9177:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9214:Dnah12	UTSW	14	26723905	missense	probably benign	0.02
R9268:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9274:Dnah12	UTSW	14	26815417	missense	probably benign	0.00
R9293:Dnah12	UTSW	14	26773059	missense	probably benign
R9322:Dnah12	UTSW	14	26770977	missense	possibly damaging	0.75
R9353:Dnah12	UTSW	14	26856550	missense	probably damaging	1.00
R9506:Dnah12	UTSW	14	26792211	missense	probably benign	0.00
R9518:Dnah12	UTSW	14	26773756	missense	probably damaging	1.00
R9524:Dnah12	UTSW	14	26850537	missense	probably null	0.91
R9562:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9565:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9573:Dnah12	UTSW	14	26693464	missense	probably benign
R9581:Dnah12	UTSW	14	26770028	missense	probably damaging	1.00
R9689:Dnah12	UTSW	14	26868914	missense	probably null	1.00
R9727:Dnah12	UTSW	14	26801553	nonsense	probably null
V7580:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
V7581:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
X0018:Dnah12	UTSW	14	26814480	missense	probably damaging	1.00
X0027:Dnah12	UTSW	14	26816288	missense	probably damaging	1.00
X0065:Dnah12	UTSW	14	26814645	missense	possibly damaging	0.93
Z1177:Dnah12	UTSW	14	26875215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGTTTCAAAACCGAGTGC -3'
(R):5'- ACAATCAATTGGGCCTCTAGC -3'

Sequencing Primer
(F):5'- GTTTCAAAACCGAGTGCTTACAC -3'
(R):5'- GGCCTCTAGCTCTATTGATGAAC -3'

Posted On

2017-02-28