Mutagenetix > Incidental Mutation

Incidental Mutation 'R1966:Ulk4'

218971

Institutional Source

Beutler Lab

Gene Symbol

Ulk4

Ensembl Gene

ENSMUSG00000040936

Gene Name

unc-51-like kinase 4

Synonyms

4932415A06Rik

MMRRC Submission

039979-MU

Accession Numbers

Genbank: NM_177589; MGI: 1921622

Essential gene?

Probably essential (E-score: 0.753) question?

Stock #

R1966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120955351-121277197 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121257116 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 350 (M350L)

Ref Sequence

ENSEMBL: ENSMUSP00000131342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000051479
AA Change: M350L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: M350L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	9.9e-26	PFAM
Pfam:Pkinase	4	280	4.6e-49	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051565

SMART Domains

Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

Domain	Start	End	E-Value	Type
SCOP:d1jvpp_	1	32	9e-6	SMART
Blast:S_TKc	4	45	2e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164336

Predicted Effect

probably benign
Transcript: ENSMUST00000170237
AA Change: M48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000171061
AA Change: M350L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: M350L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	4.3e-26	PFAM
Pfam:Pkinase	4	280	2.1e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171923
AA Change: M350L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: M350L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	153	3.1e-14	PFAM
Pfam:Pkinase	4	280	4.9e-50	PFAM
Pfam:Pkinase_Tyr	165	277	6.1e-10	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1171	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	A	G	16: 8,830,581	E41G	possibly damaging	Het
2410002F23Rik	T	A	7: 44,251,226	V185E	probably benign	Het
Abca1	A	C	4: 53,050,409	V1608G	probably damaging	Het
Ap2b1	T	C	11: 83,346,895	I557T	probably benign	Het
Arhgef15	G	T	11: 68,954,675	P117Q	probably damaging	Het
Arhgef39	T	C	4: 43,496,710	S335G	probably benign	Het
Blm	A	T	7: 80,513,186	F139Y	possibly damaging	Het
Cacna2d1	C	T	5: 16,333,785	R581*	probably null	Het
Cadps	C	A	14: 12,822,450	E97*	probably null	Het
Cavin2	T	A	1: 51,289,642	L86Q	probably damaging	Het
Ccdc136	A	G	6: 29,418,092	E787G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cdh23	T	C	10: 60,323,582	Y2138C	probably damaging	Het
Cdk12	T	A	11: 98,204,090	Y241*	probably null	Het
Clcn4	T	A	7: 7,284,185	*688L	probably null	Het
Cntnap1	T	C	11: 101,180,386	V375A	possibly damaging	Het
Coq5	T	A	5: 115,294,831		probably null	Het
Cyp4b1	A	G	4: 115,625,879	I405T	probably benign	Het
Det1	T	C	7: 78,843,218	Y346C	probably damaging	Het
Enpp3	A	T	10: 24,807,491	V276E	probably damaging	Het
Epb41l2	G	A	10: 25,441,768	R61Q	probably benign	Het
Fam76b	G	A	9: 13,828,066		probably null	Het
Fbxo45	A	T	16: 32,233,230	D238E	probably benign	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gm14139	T	A	2: 150,191,907	D49E	probably benign	Het
Gnao1	C	A	8: 93,944,199	T102K	probably benign	Het
Gpatch2	T	A	1: 187,322,301	D76E	probably damaging	Het
Gpd1l	A	G	9: 114,914,394	I146T	probably benign	Het
Grik2	A	T	10: 49,355,909	H508Q	probably damaging	Het
Hk3	A	T	13: 55,014,455	F112Y	probably damaging	Het
Hmcn2	T	G	2: 31,389,329	I1781S	probably damaging	Het
Inhba	A	T	13: 16,026,636	K261M	probably damaging	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcna2	T	C	3: 107,104,630	S176P	probably damaging	Het
Kcnj3	A	T	2: 55,437,331	Q44L	probably damaging	Het
Kcns1	G	T	2: 164,168,535	F101L	probably damaging	Het
Kdm5b	T	A	1: 134,613,873		probably null	Het
Klhl14	C	T	18: 21,554,673	G564D	probably damaging	Het
Klhl18	A	T	9: 110,476,590	V2E	probably benign	Het
Klhl6	T	C	16: 19,982,822	E61G	probably damaging	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lama5	C	A	2: 180,188,352	C1896F	probably damaging	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Lrch3	A	G	16: 32,914,385	T82A	possibly damaging	Het
Maml3	C	G	3: 52,104,139	G2A	unknown	Het
Mapkap1	T	A	2: 34,518,679	N34K	probably damaging	Het
Muc13	A	T	16: 33,814,539	I488F	probably damaging	Het
Muc5ac	A	G	7: 141,803,376	D1129G	possibly damaging	Het
Nacc1	A	T	8: 84,676,381	N288K	probably damaging	Het
Nek1	T	G	8: 61,016,296	I129R	probably damaging	Het
Nf1	T	A	11: 79,411,564	S319R	possibly damaging	Het
Nle1	C	T	11: 82,901,788	G432D	probably damaging	Het
Nol4l	A	G	2: 153,529,455	V103A	probably benign	Het
Oca2	A	G	7: 56,414,467	I737V	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr231	G	T	1: 174,117,251	S255*	probably null	Het
Olfr346	G	A	2: 36,688,784	V261I	probably benign	Het
Olfr358	A	T	2: 37,004,948	F222Y	possibly damaging	Het
Olfr630	G	T	7: 103,755,168	T139K	probably damaging	Het
Olfr655	A	G	7: 104,596,801	C127R	probably damaging	Het
Olfr750	T	A	14: 51,071,157	I79F	probably damaging	Het
Orc1	T	A	4: 108,612,217	I746N	probably damaging	Het
Pbxip1	A	G	3: 89,445,488	D147G	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plin5	T	A	17: 56,112,186	D412V	probably damaging	Het
Plxna2	A	T	1: 194,644,700	Y314F	possibly damaging	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Prss38	T	C	11: 59,373,484	Y219C	probably damaging	Het
Ptx3	C	T	3: 66,224,621	R188C	probably damaging	Het
Ralgds	T	A	2: 28,545,875	V504E	probably damaging	Het
Rere	T	C	4: 150,616,873	Y1237H	probably damaging	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Rrp15	C	T	1: 186,736,205	V205I	possibly damaging	Het
Scpep1	A	G	11: 88,952,414	W73R	probably damaging	Het
Sec23ip	A	G	7: 128,755,353	H376R	probably damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Shtn1	T	G	19: 58,975,038	Y615S	probably benign	Het
Slc20a2	C	A	8: 22,545,537	P184T	probably damaging	Het
Slc22a29	C	A	19: 8,218,408	R89L	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Tas2r122	A	T	6: 132,711,194	Y245*	probably null	Het
Ticrr	C	A	7: 79,694,735	C1449*	probably null	Het
Tmem181a	T	C	17: 6,303,226	V412A	probably benign	Het
Tmtc4	T	A	14: 122,927,599	E616V	probably benign	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Trpm8	T	A	1: 88,332,748		probably null	Het
Ubr2	T	C	17: 46,954,919	T1163A	probably benign	Het
Ubr4	A	G	4: 139,451,244		probably null	Het
Ulk2	A	T	11: 61,819,471		probably null	Het
Vmn1r185	T	C	7: 26,611,531	E183G	probably benign	Het
Vmn1r76	T	A	7: 11,930,514	I223F	probably damaging	Het
Wdr27	T	C	17: 14,934,599	T19A	possibly damaging	Het
Wdr59	T	G	8: 111,450,903	T973P	possibly damaging	Het
Wnk2	A	G	13: 49,039,011	S664P	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp30	C	A	7: 29,792,452	Q44K	probably benign	Het
Zfp541	T	C	7: 16,079,071	S550P	probably benign	Het
Zw10	C	A	9: 49,068,833	N421K	probably damaging	Het

Other mutations in Ulk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01122:Ulk4	APN	9	121168292	missense	possibly damaging	0.48
IGL01345:Ulk4	APN	9	121208162	missense	possibly damaging	0.48
IGL01432:Ulk4	APN	9	121266301	missense	probably damaging	1.00
IGL01807:Ulk4	APN	9	121255185	missense	probably damaging	1.00
IGL02139:Ulk4	APN	9	121141831	splice site	probably null
IGL02266:Ulk4	APN	9	121081700	missense	probably benign	0.10
IGL02511:Ulk4	APN	9	121188354	missense	probably damaging	1.00
IGL02546:Ulk4	APN	9	121152307	nonsense	probably null
IGL02687:Ulk4	APN	9	121192662	missense	possibly damaging	0.89
IGL03220:Ulk4	APN	9	121145336	missense	probably damaging	1.00
3-1:Ulk4	UTSW	9	121255171	missense	probably benign	0.02
R0031:Ulk4	UTSW	9	121272982	missense	probably damaging	1.00
R0433:Ulk4	UTSW	9	121044819	missense	probably benign	0.27
R0513:Ulk4	UTSW	9	121152325	missense	probably benign	0.13
R0524:Ulk4	UTSW	9	121252651	critical splice donor site	probably null
R1268:Ulk4	UTSW	9	121257074	splice site	probably benign
R1439:Ulk4	UTSW	9	121266258	missense	possibly damaging	0.58
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1531:Ulk4	UTSW	9	121044775	missense	probably damaging	0.97
R1595:Ulk4	UTSW	9	121044838	missense	probably damaging	0.96
R1620:Ulk4	UTSW	9	121204805	missense	possibly damaging	0.81
R1835:Ulk4	UTSW	9	121168184	missense	probably null	1.00
R2129:Ulk4	UTSW	9	121152182	missense	probably benign	0.03
R2329:Ulk4	UTSW	9	121272887	missense	probably damaging	1.00
R2877:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R2878:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R3734:Ulk4	UTSW	9	121261989	missense	probably benign	0.21
R3769:Ulk4	UTSW	9	121263700	missense	probably benign	0.00
R4005:Ulk4	UTSW	9	121168199	missense	possibly damaging	0.94
R4024:Ulk4	UTSW	9	121044849	missense	possibly damaging	0.86
R4321:Ulk4	UTSW	9	121073996	missense	probably benign	0.00
R4461:Ulk4	UTSW	9	121156884	missense	possibly damaging	0.83
R4537:Ulk4	UTSW	9	121263638	nonsense	probably null
R4542:Ulk4	UTSW	9	121263638	nonsense	probably null
R4572:Ulk4	UTSW	9	121192764	missense	probably damaging	1.00
R4647:Ulk4	UTSW	9	121141852	missense	probably benign	0.15
R4712:Ulk4	UTSW	9	121244370	missense	probably benign	0.23
R4730:Ulk4	UTSW	9	121263725	missense	probably benign	0.05
R4731:Ulk4	UTSW	9	121263638	nonsense	probably null
R4732:Ulk4	UTSW	9	121263638	nonsense	probably null
R4733:Ulk4	UTSW	9	121263638	nonsense	probably null
R4737:Ulk4	UTSW	9	121073872	nonsense	probably null
R4781:Ulk4	UTSW	9	121103576	missense	probably benign	0.00
R4860:Ulk4	UTSW	9	121250902	missense	possibly damaging	0.68
R4926:Ulk4	UTSW	9	121258732	missense	probably benign	0.00
R4990:Ulk4	UTSW	9	121192786	missense	probably benign	0.01
R6056:Ulk4	UTSW	9	121272955	missense	probably damaging	1.00
R6448:Ulk4	UTSW	9	121103630	missense	probably damaging	0.99
R6546:Ulk4	UTSW	9	121141894	missense	probably damaging	1.00
R6668:Ulk4	UTSW	9	121188342	missense	probably damaging	1.00
R6915:Ulk4	UTSW	9	121258820	missense	probably benign
R6929:Ulk4	UTSW	9	121074015	missense	probably benign	0.02
R7069:Ulk4	UTSW	9	121258810	missense	probably benign	0.01
R7069:Ulk4	UTSW	9	121266517	missense	probably benign	0.25
R7293:Ulk4	UTSW	9	121255124	missense	probably damaging	1.00
R7299:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7301:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7337:Ulk4	UTSW	9	121248927	missense	probably benign	0.44
R7395:Ulk4	UTSW	9	121255112	missense	probably benign
R7423:Ulk4	UTSW	9	121103621	missense	possibly damaging	0.48
R7545:Ulk4	UTSW	9	121141838	missense	probably benign	0.00
R7753:Ulk4	UTSW	9	121266512	critical splice donor site	probably null
R7790:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7791:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7793:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7834:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7836:Ulk4	UTSW	9	121044819	missense	possibly damaging	0.72
R7960:Ulk4	UTSW	9	121272956	missense	probably damaging	1.00
R8087:Ulk4	UTSW	9	121266251	missense	probably damaging	0.99
R8203:Ulk4	UTSW	9	121168208	missense	probably damaging	0.96
R8246:Ulk4	UTSW	9	121156875	makesense	probably null
R8430:Ulk4	UTSW	9	121257078	critical splice donor site	probably null
R8841:Ulk4	UTSW	9	121204738	missense	probably damaging	1.00
R9014:Ulk4	UTSW	9	121188228	missense	probably benign	0.00
R9092:Ulk4	UTSW	9	121073937	missense
R9126:Ulk4	UTSW	9	121261922	missense	probably damaging	0.99
R9176:Ulk4	UTSW	9	121145062	missense	probably benign
R9235:Ulk4	UTSW	9	121152151	missense	probably benign	0.13
R9713:Ulk4	UTSW	9	121044796	nonsense	probably null
X0024:Ulk4	UTSW	9	121192753	missense	probably damaging	1.00
X0066:Ulk4	UTSW	9	121262606	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGATGAGCACTGACTCTCTTC -3'
(R):5'- AGCCCTAAGAATGGACAAGC -3'

Sequencing Primer
(F):5'- ATGAGCACTGACTCTCTTCAAGGC -3'
(R):5'- CCAGTCTTTCAGGCTAGGTAAG -3'

Posted On

2014-08-25