Mutagenetix > Incidental Mutations

Incidental Mutation 'R1268:Ulk4'

151215

Institutional Source

Beutler Lab

Gene Symbol

Ulk4

Ensembl Gene

ENSMUSG00000040936

Gene Name

unc-51-like kinase 4

Synonyms

4932415A06Rik

MMRRC Submission

039335-MU

Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene?

Probably essential (E-score: 0.756) question?

Stock #

R1268 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120955351-121277197 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 121257074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000051479

SMART Domains

Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	9.9e-26	PFAM
Pfam:Pkinase	4	280	4.6e-49	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051565

SMART Domains

Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

Domain	Start	End	E-Value	Type
SCOP:d1jvpp_	1	32	9e-6	SMART
Blast:S_TKc	4	45	2e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164336

Predicted Effect

probably benign
Transcript: ENSMUST00000170237

Predicted Effect

probably benign
Transcript: ENSMUST00000171061

SMART Domains

Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	4.3e-26	PFAM
Pfam:Pkinase	4	280	2.1e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171923

SMART Domains

Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	153	3.1e-14	PFAM
Pfam:Pkinase	4	280	4.9e-50	PFAM
Pfam:Pkinase_Tyr	165	277	6.1e-10	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1171	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	T	C	17: 13,887,986	V1257A	probably damaging	Het
Aplnr	A	G	2: 85,137,431	T267A	possibly damaging	Het
Arap2	A	G	5: 62,730,621	S461P	probably benign	Het
Brpf3	A	G	17: 28,836,556	T1160A	probably damaging	Het
Col5a1	A	T	2: 28,002,489	T1005S	unknown	Het
Crebrf	CTTTT	CTTT	17: 26,739,596		probably null	Het
Fmo6	A	T	1: 162,920,517	I326N	probably damaging	Het
Foxp4	G	C	17: 47,880,353		probably benign	Het
Gnat1	A	G	9: 107,675,877		probably benign	Het
Hs6st1	T	A	1: 36,068,926	V90D	probably damaging	Het
Igsf11	A	G	16: 39,024,854	T257A	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Mab21l3	C	T	3: 101,835,047	E66K	possibly damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mybl2	A	G	2: 163,074,716	N429S	probably benign	Het
Mycbp2	G	A	14: 103,208,782	T1837I	probably damaging	Het
Myh7b	C	A	2: 155,614,046	S117*	probably null	Het
Nek1	C	A	8: 61,022,264	A202E	probably damaging	Het
Notum	C	T	11: 120,658,667	W159*	probably null	Het
Ntn1	TCCTCGGC	TC	11: 68,213,133		probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1308	G	T	2: 111,960,877	N65K	possibly damaging	Het
Olfr1364	C	T	13: 21,574,328	V43M	probably benign	Het
Olfr1451	T	C	19: 12,999,261	Y92H	possibly damaging	Het
Olfr48	A	G	2: 89,844,154	I273T	probably damaging	Het
Olfr494	A	T	7: 108,367,795	I102F	probably benign	Het
Olfr834	T	C	9: 18,988,356	F123L	probably damaging	Het
Plk4	T	A	3: 40,811,369	V659D	probably damaging	Het
Rbm27	T	C	18: 42,333,302	S866P	probably damaging	Het
Rnaseh2b	A	T	14: 62,372,455	K303N	possibly damaging	Het
Samd9l	C	T	6: 3,376,113	V383I	possibly damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slc35f2	T	A	9: 53,797,913	Y62*	probably null	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Ulk1	A	G	5: 110,790,277	S610P	probably damaging	Het
Vdr	T	C	15: 97,857,475	N389S	probably benign	Het

Other mutations in Ulk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01122:Ulk4	APN	9	121168292	missense	possibly damaging	0.48
IGL01345:Ulk4	APN	9	121208162	missense	possibly damaging	0.48
IGL01432:Ulk4	APN	9	121266301	missense	probably damaging	1.00
IGL01807:Ulk4	APN	9	121255185	missense	probably damaging	1.00
IGL02139:Ulk4	APN	9	121141831	splice site	probably null
IGL02266:Ulk4	APN	9	121081700	missense	probably benign	0.10
IGL02511:Ulk4	APN	9	121188354	missense	probably damaging	1.00
IGL02546:Ulk4	APN	9	121152307	nonsense	probably null
IGL02687:Ulk4	APN	9	121192662	missense	possibly damaging	0.89
IGL03220:Ulk4	APN	9	121145336	missense	probably damaging	1.00
3-1:Ulk4	UTSW	9	121255171	missense	probably benign	0.02
R0031:Ulk4	UTSW	9	121272982	missense	probably damaging	1.00
R0433:Ulk4	UTSW	9	121044819	missense	probably benign	0.27
R0513:Ulk4	UTSW	9	121152325	missense	probably benign	0.13
R0524:Ulk4	UTSW	9	121252651	critical splice donor site	probably null
R1439:Ulk4	UTSW	9	121266258	missense	possibly damaging	0.58
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1531:Ulk4	UTSW	9	121044775	missense	probably damaging	0.97
R1595:Ulk4	UTSW	9	121044838	missense	probably damaging	0.96
R1620:Ulk4	UTSW	9	121204805	missense	possibly damaging	0.81
R1835:Ulk4	UTSW	9	121168184	missense	probably null	1.00
R1966:Ulk4	UTSW	9	121257116	missense	probably benign
R2129:Ulk4	UTSW	9	121152182	missense	probably benign	0.03
R2329:Ulk4	UTSW	9	121272887	missense	probably damaging	1.00
R2877:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R2878:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R3734:Ulk4	UTSW	9	121261989	missense	probably benign	0.21
R3769:Ulk4	UTSW	9	121263700	missense	probably benign	0.00
R4005:Ulk4	UTSW	9	121168199	missense	possibly damaging	0.94
R4024:Ulk4	UTSW	9	121044849	missense	possibly damaging	0.86
R4321:Ulk4	UTSW	9	121073996	missense	probably benign	0.00
R4461:Ulk4	UTSW	9	121156884	missense	possibly damaging	0.83
R4537:Ulk4	UTSW	9	121263638	nonsense	probably null
R4542:Ulk4	UTSW	9	121263638	nonsense	probably null
R4572:Ulk4	UTSW	9	121192764	missense	probably damaging	1.00
R4647:Ulk4	UTSW	9	121141852	missense	probably benign	0.15
R4712:Ulk4	UTSW	9	121244370	missense	probably benign	0.23
R4730:Ulk4	UTSW	9	121263725	missense	probably benign	0.05
R4731:Ulk4	UTSW	9	121263638	nonsense	probably null
R4732:Ulk4	UTSW	9	121263638	nonsense	probably null
R4733:Ulk4	UTSW	9	121263638	nonsense	probably null
R4737:Ulk4	UTSW	9	121073872	nonsense	probably null
R4781:Ulk4	UTSW	9	121103576	missense	probably benign	0.00
R4860:Ulk4	UTSW	9	121250902	missense	possibly damaging	0.68
R4926:Ulk4	UTSW	9	121258732	missense	probably benign	0.00
R4990:Ulk4	UTSW	9	121192786	missense	probably benign	0.01
R6056:Ulk4	UTSW	9	121272955	missense	probably damaging	1.00
R6448:Ulk4	UTSW	9	121103630	missense	probably damaging	0.99
R6546:Ulk4	UTSW	9	121141894	missense	probably damaging	1.00
R6668:Ulk4	UTSW	9	121188342	missense	probably damaging	1.00
R6915:Ulk4	UTSW	9	121258820	missense	probably benign
R6929:Ulk4	UTSW	9	121074015	missense	probably benign	0.02
R7069:Ulk4	UTSW	9	121258810	missense	probably benign	0.01
R7069:Ulk4	UTSW	9	121266517	missense	probably benign	0.25
R7293:Ulk4	UTSW	9	121255124	missense	probably damaging	1.00
R7299:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7301:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7337:Ulk4	UTSW	9	121248927	missense	probably benign	0.44
R7395:Ulk4	UTSW	9	121255112	missense	probably benign
R7423:Ulk4	UTSW	9	121103621	missense	possibly damaging	0.48
R7545:Ulk4	UTSW	9	121141838	missense	probably benign	0.00
R7753:Ulk4	UTSW	9	121266512	critical splice donor site	probably null
R7790:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7791:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7793:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7834:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7836:Ulk4	UTSW	9	121044819	missense	possibly damaging	0.72
R7960:Ulk4	UTSW	9	121272956	missense	probably damaging	1.00
R8087:Ulk4	UTSW	9	121266251	missense	probably damaging	0.99
R8203:Ulk4	UTSW	9	121168208	missense	probably damaging	0.96
R8246:Ulk4	UTSW	9	121156875	makesense	probably null
R8430:Ulk4	UTSW	9	121257078	critical splice donor site	probably null
R8841:Ulk4	UTSW	9	121204738	missense	probably damaging	1.00
R9014:Ulk4	UTSW	9	121188228	missense	probably benign	0.00
R9092:Ulk4	UTSW	9	121073937	missense
R9126:Ulk4	UTSW	9	121261922	missense	probably damaging	0.99
R9176:Ulk4	UTSW	9	121145062	missense	probably benign
R9235:Ulk4	UTSW	9	121152151	missense	probably benign	0.13
X0024:Ulk4	UTSW	9	121192753	missense	probably damaging	1.00
X0066:Ulk4	UTSW	9	121262606	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATGGCACTCATGACGATGTGTTC -3'
(R):5'- TCATCGGCTCAGCCAGTCTTTCAG -3'

Sequencing Primer
(F):5'- TGTTCTGCACACGCACAC -3'
(R):5'- CCAGTCTTTCAGGCTAGGTAAG -3'

Posted On

2014-01-29