Incidental Mutation 'R0201:Enpp1'
ID23650
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission 038458-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R0201 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24653917 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 608 (T608S)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105520
AA Change: T608S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: T608S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135846
AA Change: T608S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: T608S

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.2%
Validation Efficiency 97% (91/94)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A G 14: 68,581,957 probably null Het
Adamts16 T A 13: 70,779,644 Q492L possibly damaging Het
Aplnr A G 2: 85,137,177 D182G probably damaging Het
Arnt2 G T 7: 84,361,659 S3* probably null Het
Asxl3 T C 18: 22,523,154 V1407A probably benign Het
Atg13 A T 2: 91,684,762 probably null Het
Atm A T 9: 53,454,279 probably benign Het
Birc6 T G 17: 74,609,327 V1746G possibly damaging Het
Cbln1 G T 8: 87,472,113 T43K probably benign Het
Cbx5 T C 15: 103,199,700 T173A probably damaging Het
Cc2d2a A G 5: 43,737,512 Y1437C probably damaging Het
Ccdc78 C A 17: 25,789,236 probably benign Het
Cd2bp2 A G 7: 127,193,828 Y341H probably damaging Het
Cdhr5 T A 7: 141,276,378 D88V probably damaging Het
Ces1f T A 8: 93,267,329 T275S probably null Het
Clca4a T C 3: 144,960,717 N458S probably benign Het
Cog5 A G 12: 31,839,841 K521R probably damaging Het
Csf2ra T A 19: 61,225,568 T305S probably benign Het
Csmd3 T A 15: 47,619,729 probably benign Het
Cts6 T A 13: 61,201,499 R132* probably null Het
D5Ertd579e G T 5: 36,616,465 N195K probably damaging Het
Ddx1 A G 12: 13,223,808 V606A probably damaging Het
Dip2b G A 15: 100,186,147 D884N probably damaging Het
Ehhadh A G 16: 21,773,493 probably null Het
Fancm T C 12: 65,101,632 Y674H probably damaging Het
Fat4 T A 3: 38,891,596 V1546D probably damaging Het
Fsd1 G A 17: 55,990,522 A158T probably benign Het
Fzd2 T A 11: 102,606,122 M464K probably damaging Het
Gjc2 A G 11: 59,177,590 F22S possibly damaging Het
Gm13101 T C 4: 143,964,890 E421G probably damaging Het
Gria2 T C 3: 80,707,838 Y445C probably damaging Het
Hsdl1 T A 8: 119,566,256 I147F possibly damaging Het
Ifi44 T C 3: 151,745,636 Y226C probably damaging Het
Il16 A G 7: 83,722,308 C97R probably damaging Het
Impg1 A T 9: 80,345,561 S369T probably damaging Het
Jmjd1c A G 10: 67,219,109 T390A unknown Het
Lgi1 A G 19: 38,301,293 E269G possibly damaging Het
Lrp6 G T 6: 134,450,897 Y1577* probably null Het
Lrrc74a G T 12: 86,761,773 probably benign Het
Man1c1 A T 4: 134,640,398 probably null Het
Map1lc3b A C 8: 121,590,550 Q9P possibly damaging Het
Mboat1 G A 13: 30,202,375 R124H probably benign Het
Mcu A G 10: 59,456,677 L60P probably damaging Het
Mrs2 G T 13: 25,018,534 Q75K probably benign Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Neb G A 2: 52,206,878 probably benign Het
Nlrp2 C T 7: 5,328,329 G356D probably benign Het
Notch3 A G 17: 32,156,148 probably benign Het
Npr2 A C 4: 43,641,617 S474R probably damaging Het
Nupl1 A G 14: 60,244,616 F100L probably benign Het
Osbpl6 A C 2: 76,546,042 D87A possibly damaging Het
Pabpc2 A T 18: 39,775,307 M542L probably benign Het
Papln A G 12: 83,783,027 probably benign Het
Parpbp T C 10: 88,092,896 I561V possibly damaging Het
Pcdhb13 C T 18: 37,442,581 A4V probably benign Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Poldip3 T A 15: 83,135,296 M182L probably benign Het
Por T C 5: 135,731,178 S240P possibly damaging Het
Pramef20 A T 4: 144,377,273 probably benign Het
Prss22 A T 17: 23,996,301 V167D probably damaging Het
Prss37 A C 6: 40,516,349 L61R probably damaging Het
Psmd1 C T 1: 86,118,616 T702M probably benign Het
Pxdn G T 12: 30,002,431 G869V possibly damaging Het
Rabgap1l A G 1: 160,453,745 probably benign Het
Rapgef6 T C 11: 54,619,941 V228A probably damaging Het
Rnf169 T C 7: 99,926,003 R462G possibly damaging Het
Rnft2 A G 5: 118,194,680 probably benign Het
Sgo2b T C 8: 63,926,636 D1054G probably benign Het
Sh3bgr T C 16: 96,228,517 probably benign Het
Slc12a4 A G 8: 105,945,350 V910A possibly damaging Het
Slc6a12 A T 6: 121,355,372 I222F probably benign Het
Spty2d1 G A 7: 46,997,901 R427* probably null Het
Ssc5d A G 7: 4,944,663 T1339A probably benign Het
Sspo A C 6: 48,455,752 E854A possibly damaging Het
Stx7 A G 10: 24,185,079 probably benign Het
Styk1 A T 6: 131,301,730 probably benign Het
Tex33 T A 15: 78,378,828 M209L probably damaging Het
Tmem163 T G 1: 127,668,637 probably benign Het
Tmppe C CT 9: 114,404,639 probably null Het
Tmx2 A G 2: 84,673,082 V229A probably benign Het
Top2b T C 14: 16,383,174 L54P probably damaging Het
Trim62 A T 4: 128,902,550 Y280F probably benign Het
Tssk4 A T 14: 55,651,559 K181* probably null Het
Tssk4 A T 14: 55,651,560 K181M probably damaging Het
Ubn1 A G 16: 5,064,614 D313G probably damaging Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Ugt1a10 C T 1: 88,218,249 P473L probably damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 intron probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
R8073:Enpp1 UTSW 10 24679244 missense possibly damaging 0.50
Z1177:Enpp1 UTSW 10 24661942 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTAGAGTTCAGCCCAACTGCCTTC -3'
(R):5'- ACTTACTGGGTTTGATCCCAGCTCC -3'

Sequencing Primer
(F):5'- gagagagagagagagagagagag -3'
(R):5'- TTGATCCCAGCTCCCAATAATGG -3'
Posted On2013-04-16