Incidental Mutation 'R2320:Ncan'
ID245609
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Nameneurocan
SynonymsCspg3, Cspg3-rs, neurocan, Tgfbit
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70093085-70120873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70108218 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 700 (I700V)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: I700V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: I700V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R7973:Ncan UTSW 8 70097575 missense probably benign 0.00
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8269:Ncan UTSW 8 70107680 missense probably benign 0.01
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGGGACTCCCTGGTAAG -3'
(R):5'- GACTTCCCCATTGTAGCCATG -3'

Sequencing Primer
(F):5'- GGACTCCCTGGTAAGTCCAAGAC -3'
(R):5'- ATTGTAGCCATGCTTCGAGC -3'
Posted On2014-10-30