Incidental Mutation 'R9803:Ncan'
ID 735322
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3, Cspg3-rs, neurocan, Tgfbit
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9803 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70093085-70120873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70108101 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 739 (D739N)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: D739N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: D739N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A G 5: 113,703,903 S52P unknown Het
Ank2 A G 3: 126,959,077 M330T possibly damaging Het
Ankar C T 1: 72,659,181 V905I possibly damaging Het
Anln G T 9: 22,372,222 D438E probably damaging Het
C1ql3 T C 2: 13,004,389 N215S probably damaging Het
Ccdc110 A G 8: 45,942,589 S506G probably benign Het
Ccdc87 A G 19: 4,841,147 T556A probably benign Het
Cma1 A T 14: 55,941,729 N236K probably benign Het
Csmd2 T C 4: 128,369,193 F724S Het
Cts8 T C 13: 61,253,322 K130R possibly damaging Het
Daam1 A T 12: 71,944,148 T179S unknown Het
Fancd2os T C 6: 113,597,977 T23A possibly damaging Het
Gbgt1 T A 2: 28,504,854 I168N probably damaging Het
Gckr G A 5: 31,300,024 G127D probably damaging Het
Gm11444 G A 11: 85,846,873 Q164* probably null Het
Gm28042 T A 2: 120,038,503 V526E possibly damaging Het
Gm8947 T C 1: 151,192,971 V185A possibly damaging Het
Hoxd13 C A 2: 74,668,903 H198Q possibly damaging Het
Hps6 T A 19: 46,005,508 L628* probably null Het
Igha G A 12: 113,259,139 H221Y Het
Ighm A G 12: 113,419,015 S453P Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Lfng A G 5: 140,607,773 T120A probably damaging Het
Lrrc4 C T 6: 28,662,200 A172T probably benign Het
Lrrc56 A G 7: 141,207,607 T386A probably benign Het
Mapkbp1 A T 2: 120,010,775 H81L probably benign Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Mrto4 T A 4: 139,349,070 N70I probably damaging Het
Mxra8 C T 4: 155,839,825 probably benign Het
Myo1h A G 5: 114,345,936 E548G Het
Olfr315 T C 11: 58,778,769 V214A probably benign Het
Oxgr1 T C 14: 120,022,151 T215A possibly damaging Het
Pcdhgb7 T A 18: 37,752,035 V86E probably damaging Het
Pclo G A 5: 14,712,615 V416M Het
Phf3 G T 1: 30,830,791 T392K probably benign Het
Pkhd1 A T 1: 20,566,849 V379E probably damaging Het
Ppfia3 T C 7: 45,341,115 Y1080C probably benign Het
Ptprs C A 17: 56,422,217 G1254C probably damaging Het
Qsox1 A T 1: 155,782,670 D384E probably benign Het
Rergl A G 6: 139,500,763 F23L probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Sidt2 A G 9: 45,943,614 Y588H probably damaging Het
Tas2r139 T A 6: 42,141,132 I66K probably damaging Het
Tbc1d30 T A 10: 121,272,075 D474V probably damaging Het
Tenm4 G A 7: 96,553,478 G100D probably damaging Het
Tmem258 G A 19: 10,207,273 V75I probably benign Het
Tmem91 G T 7: 25,670,563 H95N probably damaging Het
Trps1 T C 15: 50,846,694 K87E possibly damaging Het
Tspan11 T A 6: 127,943,717 M209K probably benign Het
Tspan17 C A 13: 54,793,279 Q124K probably benign Het
Uts2b G A 16: 27,360,942 R105* probably null Het
Vmn2r110 T A 17: 20,583,468 T282S probably benign Het
Xdh T A 17: 73,922,460 M333L probably benign Het
Zbtb3 A G 19: 8,804,469 E482G probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R7973:Ncan UTSW 8 70097575 missense probably benign 0.00
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8269:Ncan UTSW 8 70107680 missense probably benign 0.01
R8947:Ncan UTSW 8 70102521 missense probably damaging 0.98
R9324:Ncan UTSW 8 70107998 missense possibly damaging 0.75
R9717:Ncan UTSW 8 70101978 missense probably damaging 1.00
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTAGGTTCCATGCTCACG -3'
(R):5'- TCCCAGAAGAACAGGCTGTC -3'

Sequencing Primer
(F):5'- TCACGGCAACCCCATGG -3'
(R):5'- GCTGTCAGGCCTGTCAG -3'
Posted On 2022-11-14