Mutagenetix > Incidental Mutation

Incidental Mutation 'R2425:Upf1'

250150

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

040387-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R2425 (G1)

Quality Score

177

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70338460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 544 (R544H)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: R555H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: R555H

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: R544H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8963

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	C	7: 120,359,810	F621S	probably damaging	Het
Abcc10	A	G	17: 46,310,157	Y976H	probably damaging	Het
Abhd6	T	A	14: 8,049,857	N215K	probably benign	Het
Adcy4	T	C	14: 55,778,017	T479A	probably damaging	Het
Amacr	A	G	15: 10,983,368	Q88R	possibly damaging	Het
Ankrd11	T	A	8: 122,893,163	I1317F	possibly damaging	Het
Ano3	C	A	2: 110,862,843	A137S	probably benign	Het
Astn1	T	G	1: 158,579,666	S562A	probably damaging	Het
Cd44	T	A	2: 102,861,586	Y119F	probably damaging	Het
CN725425	A	C	15: 91,245,855	D307A	probably damaging	Het
Col12a1	T	C	9: 79,678,366	Y1243C	probably damaging	Het
Cyp2c50	T	C	19: 40,089,848	I50T	probably benign	Het
Dhrs9	A	G	2: 69,392,964	K19E	probably benign	Het
Dnajb14	T	G	3: 137,892,905	F135V	probably null	Het
Draxin	T	A	4: 148,112,756	T195S	possibly damaging	Het
Elane	C	T	10: 79,887,776	R192C	probably benign	Het
Fam171a2	A	C	11: 102,438,361	I524S	possibly damaging	Het
Fam35a	A	G	14: 34,268,689	S87P	probably damaging	Het
Fbxo10	C	T	4: 45,051,642	E490K	possibly damaging	Het
Fkbp15	T	C	4: 62,312,365	T704A	probably benign	Het
Fndc1	T	A	17: 7,805,018	D35V	probably damaging	Het
Galntl5	A	G	5: 25,220,081	K366E	probably damaging	Het
Gas7	G	A	11: 67,643,295	A74T	probably benign	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
Gldc	T	A	19: 30,131,790	N583Y	probably damaging	Het
Gpr161	T	A	1: 165,310,623	S259R	possibly damaging	Het
Igfn1	T	A	1: 135,963,102	T2387S	probably damaging	Het
Il3	A	T	11: 54,265,549	V119D	possibly damaging	Het
Ints3	T	C	3: 90,394,110	T822A	possibly damaging	Het
Jakmip1	C	T	5: 37,141,805	Q790*	probably null	Het
Kcne1	A	G	16: 92,348,758	I66T	probably damaging	Het
Nipbl	A	G	15: 8,351,482	S609P	probably benign	Het
Olfr1053	A	G	2: 86,314,395	V297A	probably damaging	Het
Olfr330	A	G	11: 58,529,311	I225T	probably damaging	Het
Olfr975	T	C	9: 39,949,841	E310G	probably null	Het
Pdxdc1	A	T	16: 13,879,508	S103T	possibly damaging	Het
Pla2g2a	C	A	4: 138,832,918	A24E	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Pramel1	T	G	4: 143,398,466	L320R	probably damaging	Het
Rad23b	T	A	4: 55,385,438	I325N	probably damaging	Het
Rasgrp1	C	G	2: 117,289,450		probably null	Het
Rbm12b1	T	A	4: 12,146,443	I805N	probably damaging	Het
Slc12a9	G	T	5: 137,315,597	A700E	probably damaging	Het
Tbc1d24	A	T	17: 24,186,008	V54E	probably damaging	Het
Tmc8	A	G	11: 117,792,569	D650G	probably damaging	Het
Ush2a	T	A	1: 188,537,804	N1749K	possibly damaging	Het
Usp42	T	C	5: 143,715,839	T810A	probably benign	Het
Wdr70	C	A	15: 7,887,359	E526*	probably null	Het
Zfp935	G	T	13: 62,455,108	Q93K	probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GTACCGCTTCTCATCTGCAG -3'
(R):5'- TGCCTATTACAGCTGTGCAG -3'

Sequencing Primer
(F):5'- ATCTGCAGATGACAGCTCG -3'
(R):5'- GTGCAGCTTTTCCCTGGGC -3'

Posted On

2014-11-12