Incidental Mutation 'R1018:Upf1'
ID96608
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene NameUPF1 regulator of nonsense transcripts homolog (yeast)
SynonymsB430202H16Rik, PNORF-1, Rent1
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1018 (G1)
Quality Score171
Status Validated
Chromosome8
Chromosomal Location70331525-70353278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70338906 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 514 (H514Q)
Ref Sequence ENSEMBL: ENSMUSP00000075089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075666
AA Change: H514Q

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: H514Q

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215817
AA Change: H503Q

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.3019 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70338284 missense probably benign
IGL01890:Upf1 APN 8 70334230 missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70335652 critical splice donor site probably null
IGL03142:Upf1 APN 8 70333327 missense probably benign 0.04
IGL03151:Upf1 APN 8 70335387 missense probably damaging 0.98
Nanosphere UTSW 8 70344262 missense probably benign 0.01
Particulate UTSW 8 70337025 missense probably damaging 0.96
R0270:Upf1 UTSW 8 70335645 splice site probably benign
R0477:Upf1 UTSW 8 70334080 missense probably benign
R0755:Upf1 UTSW 8 70334129 missense probably benign 0.01
R1067:Upf1 UTSW 8 70338403 missense probably damaging 0.98
R1445:Upf1 UTSW 8 70341524 missense probably benign 0.00
R1458:Upf1 UTSW 8 70344254 missense probably benign 0.00
R1511:Upf1 UTSW 8 70338505 missense probably damaging 0.99
R1552:Upf1 UTSW 8 70333059 nonsense probably null
R1560:Upf1 UTSW 8 70338442 missense probably damaging 1.00
R1562:Upf1 UTSW 8 70343367 nonsense probably null
R2082:Upf1 UTSW 8 70341572 missense probably damaging 1.00
R2143:Upf1 UTSW 8 70339354 missense probably null 1.00
R2423:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R2425:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3031:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3032:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3123:Upf1 UTSW 8 70337483 splice site probably benign
R3508:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3747:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70339814 missense probably benign 0.30
R3964:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3965:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4152:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4505:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4506:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4838:Upf1 UTSW 8 70339368 missense probably benign 0.03
R5001:Upf1 UTSW 8 70334700 missense probably damaging 1.00
R5715:Upf1 UTSW 8 70352978 missense probably damaging 0.96
R5748:Upf1 UTSW 8 70338517 missense probably damaging 1.00
R5856:Upf1 UTSW 8 70334762 critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70344262 missense probably benign 0.01
R6010:Upf1 UTSW 8 70337025 missense probably damaging 0.96
R6056:Upf1 UTSW 8 70333037 missense probably damaging 0.98
R6870:Upf1 UTSW 8 70341561 missense probably benign 0.11
R7205:Upf1 UTSW 8 70340045 missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70340618 missense probably damaging 1.00
R7464:Upf1 UTSW 8 70333423 missense probably benign
R7759:Upf1 UTSW 8 70334080 missense probably benign
R7783:Upf1 UTSW 8 70352858 missense probably benign 0.11
R8079:Upf1 UTSW 8 70338884 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATAGGCAGGTACAGCCATGCCAAG -3'
(R):5'- CTCAACCACTCTCAGGTGCCATTAG -3'

Sequencing Primer
(F):5'- TGTCATCCACATGAGGCACG -3'
(R):5'- AGGTGCCATTAGGCCCC -3'
Posted On2014-01-05