Mutagenetix > Incidental Mutation

Incidental Mutation 'R1018:Upf1'

96608

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

039122-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R1018 (G1)

Quality Score

171

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 70338906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 514 (H514Q)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075666
AA Change: H514Q

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: H514Q

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215817
AA Change: H503Q

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.3019

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	G	T	10: 80,001,491	C403F	probably damaging	Het
Adam20	C	T	8: 40,796,109	Q419*	probably null	Het
Ankrd36	C	T	11: 5,646,876		probably benign	Het
Arl8b	T	A	6: 108,818,611	I170K	probably damaging	Het
Atp5f1	A	T	3: 105,954,172	V78E	possibly damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cgnl1	A	G	9: 71,726,058	Y4H	probably damaging	Het
Cnn2	T	C	10: 79,993,563	C176R	probably damaging	Het
Dst	A	G	1: 34,194,093	D3392G	probably damaging	Het
Eed	T	C	7: 89,967,811		probably benign	Het
Efl1	T	A	7: 82,763,013	V870E	possibly damaging	Het
Epx	T	C	11: 87,869,303	N495S	probably benign	Het
Fbxw20	T	A	9: 109,221,336	Y407F	probably benign	Het
Gbp9	T	A	5: 105,080,260	Q552L	probably benign	Het
Hspa13	C	A	16: 75,761,276	V134L	possibly damaging	Het
Il16	T	C	7: 83,674,538	N268S	probably damaging	Het
Kif14	G	A	1: 136,495,841		probably benign	Het
Lrig1	G	A	6: 94,622,602		probably benign	Het
Myo7a	T	A	7: 98,107,005	D29V	probably damaging	Het
Nsd2	A	G	5: 33,843,241	K34R	probably damaging	Het
Olfr1234	C	A	2: 89,363,179	L83F	possibly damaging	Het
P3h1	C	A	4: 119,237,907	T287K	probably damaging	Het
Pkhd1	A	T	1: 20,201,259	H3023Q	possibly damaging	Het
Plxna1	A	G	6: 89,342,960	L535P	probably damaging	Het
Ppp1r32	A	T	19: 10,479,460		probably benign	Het
Prom1	A	T	5: 44,029,714	S400R	probably benign	Het
Psap	T	G	10: 60,300,811	L523R	probably damaging	Het
Psme4	C	T	11: 30,804,310	T189I	probably damaging	Het
Ptpn12	A	T	5: 21,029,869	S39T	possibly damaging	Het
Qtrt2	T	A	16: 43,878,000	H98L	possibly damaging	Het
Rad54l2	C	A	9: 106,712,390	C601F	probably benign	Het
Sfswap	A	G	5: 129,554,576	K756R	possibly damaging	Het
Slc24a5	T	C	2: 125,068,907	V86A	probably damaging	Het
Srrm2	T	C	17: 23,822,540	S2575P	probably damaging	Het
Stam	T	C	2: 14,117,374		probably benign	Het
Tbx6	T	A	7: 126,783,192		probably benign	Het
Tmem131	A	C	1: 36,794,819	F1727V	probably damaging	Het
Tpr	T	A	1: 150,442,183	H2147Q	possibly damaging	Het
Trio	T	A	15: 27,871,171	H620L	probably damaging	Het
Uba5	T	C	9: 104,049,903	T292A	probably benign	Het
Unc5a	T	A	13: 54,990,952	V48E	possibly damaging	Het
Usp9y	A	G	Y: 1,341,414		probably benign	Het
Vmn2r6	T	A	3: 64,556,840	D191V	probably benign	Het
Wapl	T	C	14: 34,691,906	Y242H	possibly damaging	Het
Zfp341	A	T	2: 154,646,052	N812Y	probably damaging	Het
Zfp358	C	A	8: 3,496,843	S475*	probably null	Het
Zfp957	C	A	14: 79,212,742	C539F	probably damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATAGGCAGGTACAGCCATGCCAAG -3'
(R):5'- CTCAACCACTCTCAGGTGCCATTAG -3'

Sequencing Primer
(F):5'- TGTCATCCACATGAGGCACG -3'
(R):5'- AGGTGCCATTAGGCCCC -3'

Posted On

2014-01-05