Mutagenetix > Incidental Mutation

Incidental Mutation 'R8192:Upf1'

635226

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R8192 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70340644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 288 (L288P)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666]

AlphaFold

Q9EPU0

Predicted Effect

probably benign
Transcript: ENSMUST00000075666
AA Change: L288P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: L288P

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	A	T	8: 43,650,933	D558E	probably damaging	Het
Alox15	T	A	11: 70,350,910	E48D	probably benign	Het
Alyref	T	C	11: 120,597,696	E102G	probably benign	Het
Bach2	A	G	4: 32,562,294	S254G	probably benign	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bcl2l13	A	G	6: 120,876,306	E184G	possibly damaging	Het
Best1	T	A	19: 9,986,300	I506F	possibly damaging	Het
Cd177	T	A	7: 24,754,302	D388V	probably benign	Het
Cep350	T	C	1: 155,940,783	K329E	possibly damaging	Het
Clasrp	T	C	7: 19,595,462	N65S	possibly damaging	Het
Cobl	T	C	11: 12,249,745	R1301G	probably benign	Het
Cul9	T	C	17: 46,538,347	E624G	probably benign	Het
Cyp21a1	A	T	17: 34,803,659	Y109N	probably damaging	Het
Dbf4	A	G	5: 8,398,134	S359P	probably benign	Het
Ddx60	A	G	8: 61,977,968	T846A	probably damaging	Het
Dnah11	A	G	12: 118,012,446	V2746A	probably benign	Het
Dnah12	G	A	14: 26,706,881	A221T	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dock2	A	G	11: 34,732,339		probably null	Het
Dpy19l1	T	C	9: 24,450,727	I119V	possibly damaging	Het
Dsg1c	A	G	18: 20,266,198	T120A	probably damaging	Het
Dzank1	T	C	2: 144,490,225	H397R	probably benign	Het
Fam35a	A	T	14: 34,245,216	S680T	probably benign	Het
Gaa	G	T	11: 119,270,409	A93S	possibly damaging	Het
Galnt4	G	A	10: 99,109,256	R281H	probably benign	Het
Gm13103	G	A	4: 143,851,539	W123*	probably null	Het
Gm3250	T	C	10: 77,782,457	E29G	unknown	Het
Gm5065	T	A	7: 5,359,596	D75E	possibly damaging	Het
H13	T	G	2: 152,669,602	D7E	probably benign	Het
H60c	T	A	10: 3,259,781	I140F	probably benign	Het
Hsd3b2	T	C	3: 98,713,592	N49S	probably benign	Het
Klhl11	G	T	11: 100,464,096	P300T	probably benign	Het
Knop1	C	A	7: 118,853,146	V117L		Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lrrc9	A	T	12: 72,449,389	I13F	probably damaging	Het
Macf1	A	G	4: 123,440,597	S4456P	probably damaging	Het
Mkrn1	A	T	6: 39,399,355	V439D	probably damaging	Het
Muc2	T	A	7: 141,751,478	V612D		Het
Nrxn3	A	G	12: 90,204,795	N967D	probably benign	Het
Olfr1173	A	C	2: 88,274,944	V35G	probably damaging	Het
Olfr978	T	A	9: 39,994,171	D120E	probably damaging	Het
Oprm1	C	T	10: 6,838,417	P391S	probably benign	Het
Parp14	T	A	16: 35,871,214	E47V	probably benign	Het
Pikfyve	A	G	1: 65,246,395	E931G	possibly damaging	Het
Plcz1	A	T	6: 140,023,260	C151S	probably damaging	Het
Rbm26	A	G	14: 105,142,689		probably null	Het
Rffl	G	T	11: 82,812,723		probably null	Het
Sc5d	T	C	9: 42,259,798	I32V	probably benign	Het
Scube1	A	G	15: 83,629,382		probably null	Het
Slc12a6	A	G	2: 112,351,377	Y714C	probably damaging	Het
Slc26a3	A	G	12: 31,468,542	I670V	probably benign	Het
Slc8a3	A	T	12: 81,199,681	V866D	probably damaging	Het
Slco3a1	A	T	7: 74,320,590	M423K	probably benign	Het
Smc6	A	G	12: 11,299,335	E773G	probably benign	Het
Son	A	G	16: 91,655,549	T395A	possibly damaging	Het
Ss18l1	T	C	2: 180,059,362	S290P	probably damaging	Het
Tcof1	A	C	18: 60,843,303	V78G	probably damaging	Het
Thsd1	G	A	8: 22,243,902	V322M	probably benign	Het
Tln2	A	T	9: 67,346,529	C753*	probably null	Het
Trav6n-6	T	A	14: 53,133,040	F83I	probably damaging	Het
Ttc39d	A	G	17: 80,216,578	H222R	probably damaging	Het
Ugt2b35	T	A	5: 87,001,443	S184R	probably damaging	Het
Zfp442	T	C	2: 150,408,709	I424M	unknown	Het
Zfp580	T	C	7: 5,053,115	V100A	probably benign	Het
Zfpm1	C	A	8: 122,332,094	P151Q	probably damaging	Het
Zfr2	C	T	10: 81,242,815	P294S	possibly damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GTTTCATCCAGGCTCAAGGC -3'
(R):5'- TTGAGTATGCCAGGGCCATC -3'

Sequencing Primer
(F):5'- CTCAAGGCCAGGAAGAGTCC -3'
(R):5'- GGCCATCAGAACAGTAGGCTC -3'

Posted On

2020-07-13