Incidental Mutation 'R8192:Upf1'
ID635226
Institutional Source Beutler Lab
Gene Symbol Upf1
Ensembl Gene ENSMUSG00000058301
Gene NameUPF1 regulator of nonsense transcripts homolog (yeast)
SynonymsB430202H16Rik, PNORF-1, Rent1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8192 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70331525-70353278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70340644 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 288 (L288P)
Ref Sequence ENSEMBL: ENSMUSP00000075089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666]
Predicted Effect probably benign
Transcript: ENSMUST00000075666
AA Change: L288P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: L288P

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 43,650,933 D558E probably damaging Het
Alox15 T A 11: 70,350,910 E48D probably benign Het
Alyref T C 11: 120,597,696 E102G probably benign Het
Bach2 A G 4: 32,562,294 S254G probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bcl2l13 A G 6: 120,876,306 E184G possibly damaging Het
Best1 T A 19: 9,986,300 I506F possibly damaging Het
Cd177 T A 7: 24,754,302 D388V probably benign Het
Cep350 T C 1: 155,940,783 K329E possibly damaging Het
Clasrp T C 7: 19,595,462 N65S possibly damaging Het
Cobl T C 11: 12,249,745 R1301G probably benign Het
Cul9 T C 17: 46,538,347 E624G probably benign Het
Cyp21a1 A T 17: 34,803,659 Y109N probably damaging Het
Dbf4 A G 5: 8,398,134 S359P probably benign Het
Ddx60 A G 8: 61,977,968 T846A probably damaging Het
Dnah11 A G 12: 118,012,446 V2746A probably benign Het
Dnah12 G A 14: 26,706,881 A221T probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock2 A G 11: 34,732,339 probably null Het
Dpy19l1 T C 9: 24,450,727 I119V possibly damaging Het
Dsg1c A G 18: 20,266,198 T120A probably damaging Het
Dzank1 T C 2: 144,490,225 H397R probably benign Het
Fam35a A T 14: 34,245,216 S680T probably benign Het
Gaa G T 11: 119,270,409 A93S possibly damaging Het
Galnt4 G A 10: 99,109,256 R281H probably benign Het
Gm13103 G A 4: 143,851,539 W123* probably null Het
Gm3250 T C 10: 77,782,457 E29G unknown Het
Gm5065 T A 7: 5,359,596 D75E possibly damaging Het
H13 T G 2: 152,669,602 D7E probably benign Het
H60c T A 10: 3,259,781 I140F probably benign Het
Hsd3b2 T C 3: 98,713,592 N49S probably benign Het
Klhl11 G T 11: 100,464,096 P300T probably benign Het
Knop1 C A 7: 118,853,146 V117L Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Macf1 A G 4: 123,440,597 S4456P probably damaging Het
Mkrn1 A T 6: 39,399,355 V439D probably damaging Het
Muc2 T A 7: 141,751,478 V612D Het
Nrxn3 A G 12: 90,204,795 N967D probably benign Het
Olfr1173 A C 2: 88,274,944 V35G probably damaging Het
Olfr978 T A 9: 39,994,171 D120E probably damaging Het
Oprm1 C T 10: 6,838,417 P391S probably benign Het
Parp14 T A 16: 35,871,214 E47V probably benign Het
Pikfyve A G 1: 65,246,395 E931G possibly damaging Het
Plcz1 A T 6: 140,023,260 C151S probably damaging Het
Rbm26 A G 14: 105,142,689 probably null Het
Rffl G T 11: 82,812,723 probably null Het
Sc5d T C 9: 42,259,798 I32V probably benign Het
Scube1 A G 15: 83,629,382 probably null Het
Slc12a6 A G 2: 112,351,377 Y714C probably damaging Het
Slc26a3 A G 12: 31,468,542 I670V probably benign Het
Slc8a3 A T 12: 81,199,681 V866D probably damaging Het
Slco3a1 A T 7: 74,320,590 M423K probably benign Het
Smc6 A G 12: 11,299,335 E773G probably benign Het
Son A G 16: 91,655,549 T395A possibly damaging Het
Ss18l1 T C 2: 180,059,362 S290P probably damaging Het
Tcof1 A C 18: 60,843,303 V78G probably damaging Het
Thsd1 G A 8: 22,243,902 V322M probably benign Het
Tln2 A T 9: 67,346,529 C753* probably null Het
Trav6n-6 T A 14: 53,133,040 F83I probably damaging Het
Ttc39d A G 17: 80,216,578 H222R probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Zfp442 T C 2: 150,408,709 I424M unknown Het
Zfp580 T C 7: 5,053,115 V100A probably benign Het
Zfpm1 C A 8: 122,332,094 P151Q probably damaging Het
Zfr2 C T 10: 81,242,815 P294S possibly damaging Het
Other mutations in Upf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Upf1 APN 8 70338284 missense probably benign
IGL01890:Upf1 APN 8 70334230 missense possibly damaging 0.94
IGL02534:Upf1 APN 8 70335652 critical splice donor site probably null
IGL03142:Upf1 APN 8 70333327 missense probably benign 0.04
IGL03151:Upf1 APN 8 70335387 missense probably damaging 0.98
Nanosphere UTSW 8 70344262 missense probably benign 0.01
Particulate UTSW 8 70337025 missense probably damaging 0.96
R0270:Upf1 UTSW 8 70335645 splice site probably benign
R0477:Upf1 UTSW 8 70334080 missense probably benign
R0755:Upf1 UTSW 8 70334129 missense probably benign 0.01
R1018:Upf1 UTSW 8 70338906 missense possibly damaging 0.85
R1067:Upf1 UTSW 8 70338403 missense probably damaging 0.98
R1445:Upf1 UTSW 8 70341524 missense probably benign 0.00
R1458:Upf1 UTSW 8 70344254 missense probably benign 0.00
R1511:Upf1 UTSW 8 70338505 missense probably damaging 0.99
R1552:Upf1 UTSW 8 70333059 nonsense probably null
R1560:Upf1 UTSW 8 70338442 missense probably damaging 1.00
R1562:Upf1 UTSW 8 70343367 nonsense probably null
R2082:Upf1 UTSW 8 70341572 missense probably damaging 1.00
R2143:Upf1 UTSW 8 70339354 missense probably null 1.00
R2423:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R2425:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3031:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3032:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3123:Upf1 UTSW 8 70337483 splice site probably benign
R3508:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3747:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3748:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3750:Upf1 UTSW 8 70333350 missense possibly damaging 0.75
R3754:Upf1 UTSW 8 70339814 missense probably benign 0.30
R3964:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R3965:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4152:Upf1 UTSW 8 70338460 missense probably damaging 1.00
R4505:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4506:Upf1 UTSW 8 70337566 missense probably damaging 1.00
R4838:Upf1 UTSW 8 70339368 missense probably benign 0.03
R5001:Upf1 UTSW 8 70334700 missense probably damaging 1.00
R5715:Upf1 UTSW 8 70352978 missense probably damaging 0.96
R5748:Upf1 UTSW 8 70338517 missense probably damaging 1.00
R5856:Upf1 UTSW 8 70334762 critical splice acceptor site probably null
R5930:Upf1 UTSW 8 70344262 missense probably benign 0.01
R6010:Upf1 UTSW 8 70337025 missense probably damaging 0.96
R6056:Upf1 UTSW 8 70333037 missense probably damaging 0.98
R6870:Upf1 UTSW 8 70341561 missense probably benign 0.11
R7205:Upf1 UTSW 8 70340045 missense possibly damaging 0.94
R7385:Upf1 UTSW 8 70340618 missense probably damaging 1.00
R7464:Upf1 UTSW 8 70333423 missense probably benign
R7759:Upf1 UTSW 8 70334080 missense probably benign
R7783:Upf1 UTSW 8 70352858 missense probably benign 0.11
R8079:Upf1 UTSW 8 70338884 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTTCATCCAGGCTCAAGGC -3'
(R):5'- TTGAGTATGCCAGGGCCATC -3'

Sequencing Primer
(F):5'- CTCAAGGCCAGGAAGAGTCC -3'
(R):5'- GGCCATCAGAACAGTAGGCTC -3'
Posted On2020-07-13