Mutagenetix > Incidental Mutation

Incidental Mutation 'R4152:Upf1'

314955

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

040996-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R4152 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70338460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 544 (R544H)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: R555H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: R555H

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: R544H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8963

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,156,897	H2036Q	possibly damaging	Het
Acaca	T	G	11: 84,292,926	M31R	possibly damaging	Het
Akap6	A	C	12: 53,140,407	S1535R	probably benign	Het
Ap3b2	A	G	7: 81,478,017	I137T	probably damaging	Het
Cdc16	A	G	8: 13,762,857	S36G	probably damaging	Het
Clcn4	T	C	7: 7,294,834	N67D	probably benign	Het
Col4a1	T	C	8: 11,217,227		probably null	Het
Crem	G	T	18: 3,288,055	N179K	probably damaging	Het
Fam78b	T	C	1: 167,078,800	M176T	probably benign	Het
Gcn1l1	A	G	5: 115,613,354		probably null	Het
Gm6483	T	C	8: 19,687,910		noncoding transcript	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klk1b16	T	C	7: 44,140,549	F81S	probably benign	Het
Lpgat1	C	A	1: 191,719,488	Y36*	probably null	Het
Mavs	A	G	2: 131,246,608	D444G	probably benign	Het
Ndst3	T	C	3: 123,672,227	Y32C	probably damaging	Het
Nemp2	A	G	1: 52,641,051	S145G	probably benign	Het
Olfr690	T	C	7: 105,329,385	N269S	probably damaging	Het
Olfr835	T	A	9: 19,035,520	Y132*	probably null	Het
Olfr965	A	C	9: 39,720,000	M258L	probably benign	Het
Pds5a	A	T	5: 65,666,171	C92*	probably null	Het
Pgk2	A	G	17: 40,208,258	V93A	probably damaging	Het
Phf3	C	T	1: 30,831,458	V116I	probably benign	Het
Prl8a2	T	C	13: 27,351,002	Y86H	possibly damaging	Het
Rab4b	T	C	7: 27,176,126		probably benign	Het
Rsad1	T	C	11: 94,548,623		probably benign	Het
Sim1	G	A	10: 50,983,854	C604Y	probably damaging	Het
Slc5a3	T	A	16: 92,077,808	L251*	probably null	Het
Slit3	A	G	11: 35,698,320	N1234S	probably damaging	Het
Sntg1	A	T	1: 8,583,345		probably null	Het
Snx31	T	C	15: 36,525,639	N305D	probably benign	Het
St14	T	C	9: 31,090,506	I768V	probably benign	Het
Tep1	G	A	14: 50,837,594	H1755Y	possibly damaging	Het
Tlr6	A	C	5: 64,953,212	F784C	probably damaging	Het
Tmem132a	A	G	19: 10,859,063	V701A	probably benign	Het
Tspan15	A	T	10: 62,189,842	M197K	possibly damaging	Het
Vegfb	T	C	19: 6,986,078	Y106C	probably damaging	Het
Vmn2r100	AAAACAGGAGTATTGATTGGAAAC	AAAAC	17: 19,523,419		probably null	Het
Vmn2r18	T	A	5: 151,562,265	Q588L	probably damaging	Het
Vmn2r66	T	C	7: 85,005,592	D503G	probably benign	Het
Zc3h15	T	C	2: 83,658,569	V161A	probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATCTGCAGATGACAGCTCGC -3'
(R):5'- CATGGCTGTACCTGCCTATTAC -3'

Sequencing Primer
(F):5'- GTCTCATCCTTTAGCTGCTGCAG -3'
(R):5'- TGCCTATTACAGCTGTGCAG -3'

Posted On

2015-05-14