Mutagenetix > Incidental Mutation

Incidental Mutation 'R3418:Serpinb13'

266878

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

040636-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R3418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106998927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 218 (S218P)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027564
AA Change: S218P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: S218P

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136766

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Meta Mutation Damage Score

0.2210

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5530400C23Rik	A	G	6: 133,294,119	Q42R	probably benign	Het
Acaa1a	A	G	9: 119,349,490		probably null	Het
Agbl5	T	C	5: 30,904,723	S756P	probably damaging	Het
Armc9	T	C	1: 86,194,338	L395P	probably damaging	Het
Cdc16	C	T	8: 13,769,489	Q362*	probably null	Het
Cdh5	C	T	8: 104,129,370	R312C	probably damaging	Het
Cep170b	C	T	12: 112,738,468	Q887*	probably null	Het
Chd9	T	C	8: 91,036,591	I2348T	probably damaging	Het
Clec9a	A	G	6: 129,421,038		probably benign	Het
Col6a3	T	C	1: 90,804,091	D873G	probably benign	Het
D130040H23Rik	T	C	8: 69,302,927	I328T	probably benign	Het
Dido1	G	T	2: 180,660,935	D1725E	possibly damaging	Het
Dnajb14	A	G	3: 137,892,870	D123G	probably null	Het
Dock2	A	T	11: 34,689,760	M661K	probably damaging	Het
Esam	C	T	9: 37,537,130		probably null	Het
Fam20c	A	T	5: 138,757,868	N220Y	probably damaging	Het
Fat2	G	T	11: 55,278,998	H2978Q	probably benign	Het
Fbn1	T	C	2: 125,320,926	T2147A	possibly damaging	Het
Fdft1	T	C	14: 63,156,621	T214A	probably damaging	Het
Fhl5	T	C	4: 25,211,252	S147G	probably benign	Het
Flrt2	A	G	12: 95,780,604	Y572C	probably damaging	Het
Gcat	A	T	15: 79,042,097	T56S	possibly damaging	Het
Gemin5	A	T	11: 58,156,628		probably null	Het
Gm4736	A	T	6: 132,115,677		noncoding transcript	Het
Grin2b	T	C	6: 135,843,110	N368S	probably benign	Het
Gsto1	T	C	19: 47,857,905	F64L	probably benign	Het
Gucy1a1	A	G	3: 82,106,133	S401P	probably damaging	Het
Htr1f	G	A	16: 64,925,897	P344L	probably damaging	Het
Ighv7-3	T	A	12: 114,153,299	Y81F	probably damaging	Het
Jakmip3	C	A	7: 139,017,745		probably benign	Het
Kcnj13	T	C	1: 87,386,919	T194A	probably benign	Het
Khdrbs3	T	C	15: 69,049,375		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lyn	A	T	4: 3,746,833	I204F	probably damaging	Het
Mbd6	C	G	10: 127,286,503	R152P	probably null	Het
Myof	A	G	19: 37,922,978	S1502P	probably damaging	Het
Myom2	T	G	8: 15,085,294	I499S	probably benign	Het
Nos2	T	A	11: 78,959,695	F1126L	possibly damaging	Het
Olfr399	G	A	11: 74,053,988	T257I	probably damaging	Het
P2ry1	T	C	3: 61,003,712	F91L	probably damaging	Het
Pcdh15	C	A	10: 74,584,222	D1166E	probably benign	Het
Pou6f1	C	A	15: 100,580,924	V368L	probably benign	Het
Ptcd3	A	T	6: 71,883,486	I579K	possibly damaging	Het
Rbm45	A	G	2: 76,379,018	E392G	probably damaging	Het
Rnf168	A	G	16: 32,299,192	N524D	probably benign	Het
Rnf222	G	T	11: 68,893,156	R183L	probably damaging	Het
Robo1	C	T	16: 73,035,917	T1526I	probably benign	Het
Sel1l	A	G	12: 91,810,002	W689R	probably damaging	Het
Serpini1	A	G	3: 75,640,282	Y367C	probably damaging	Het
Slc13a2	A	G	11: 78,400,840	F329S	probably benign	Het
Smc2	T	C	4: 52,476,850		probably benign	Het
Sycp2	A	T	2: 178,401,653		probably benign	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tdrd1	T	A	19: 56,831,231	N54K	possibly damaging	Het
Tgfbr2	T	C	9: 116,129,833	Y146C	probably damaging	Het
Tnfrsf11a	A	G	1: 105,809,405	D79G	possibly damaging	Het
Trpa1	T	C	1: 14,874,381	I1046M	probably benign	Het
Ubn1	A	G	16: 5,074,379		probably benign	Het
Ubp1	T	C	9: 113,951,686		probably null	Het
Vmn2r2	A	T	3: 64,116,899	F754I	probably benign	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
R9774:Serpinb13	UTSW	1	106995849	missense	probably benign	0.02
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAGTCTAATGTCATTTGGCCAAG -3'
(R):5'- AGCGAGGCATCAAATGTTCAG -3'

Sequencing Primer
(F):5'- GGCCAAGTGATTATTCAGTTACTCAG -3'
(R):5'- CAAATGTTCAGAAGCCTTGTTCCCAG -3'

Posted On

2015-02-18