Incidental Mutation 'R4077:Erbb4'
ID316587
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission 041622-MU
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4077 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68040337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1195 (T1195A)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
Predicted Effect probably benign
Transcript: ENSMUST00000119142
AA Change: T1211A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: T1211A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121473
AA Change: T1195A

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: T1195A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (81/82)
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,459 probably null Het
Adam33 T C 2: 131,063,524 probably benign Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Atrn T C 2: 130,964,930 probably null Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cdnf A G 2: 3,521,023 Y84C probably damaging Het
Chdh T C 14: 30,035,340 S407P probably damaging Het
Cmtr1 C A 17: 29,685,975 T300K probably damaging Het
Dennd2d A T 3: 106,482,623 probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
Ermard T A 17: 15,053,376 S408T probably benign Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
F13b T A 1: 139,501,770 F9I unknown Het
Fnbp4 C T 2: 90,758,477 R531* probably null Het
Gdf6 A G 4: 9,844,776 Y100C probably damaging Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm2016 A T 12: 87,876,940 D119V possibly damaging Het
Gm9774 A C 3: 92,428,888 probably benign Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Grm8 T C 6: 27,760,209 H374R probably benign Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs A G 11: 120,477,376 K277E probably damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hoxa11 A T 6: 52,245,524 Y66N probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igdcc4 T A 9: 65,131,765 L944Q probably damaging Het
Ighv3-1 C A 12: 113,964,487 S84I probably damaging Het
Iqgap2 T C 13: 95,657,867 D1199G probably damaging Het
Kcnk10 A T 12: 98,434,946 M490K probably benign Het
Kirrel A G 3: 87,085,080 probably null Het
Lias A T 5: 65,395,425 T124S probably benign Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Lrrc37a T A 11: 103,497,982 T2206S unknown Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mis12 A G 11: 71,025,308 T56A probably benign Het
Olfr1118 T A 2: 87,308,864 M25K probably null Het
Olfr1287 A G 2: 111,449,503 D121G probably damaging Het
Olfr1451 T C 19: 12,999,871 V295A probably damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Otof A T 5: 30,419,506 L134Q possibly damaging Het
Pds5b T A 5: 150,794,359 V1155E possibly damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phyhipl C T 10: 70,569,073 V57I probably damaging Het
Plekha5 T A 6: 140,555,921 probably null Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Proser1 A G 3: 53,478,541 T615A probably damaging Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rassf2 G A 2: 132,012,602 P7S probably benign Het
Sart1 A T 19: 5,382,743 L521Q possibly damaging Het
Scgb1b21 T A 7: 33,527,693 noncoding transcript Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Secisbp2l A G 2: 125,751,865 probably benign Het
Svil A G 18: 5,063,522 E931G probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tdrd1 A G 19: 56,831,073 M2V probably benign Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tram1 A G 1: 13,566,375 V358A probably benign Het
Unc13c C T 9: 73,736,539 W1214* probably null Het
Vps13b T C 15: 35,455,128 C728R probably damaging Het
Wwox A G 8: 114,439,741 probably benign Het
Zbtb41 G A 1: 139,429,326 V440I probably benign Het
Zfp777 T C 6: 48,025,522 S589G probably benign Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTCTCTGCCACAATGGGG -3'
(R):5'- GGCTCTCTTGTTCTAAAGAAGTTAACC -3'

Sequencing Primer
(F):5'- GCGGATCCGTCCATTCTG -3'
(R):5'- CTTGTTCTAAAGAAGTTAACCACTGC -3'
Posted On2015-05-15