Incidental Mutation 'R7403:Frem3'
ID574345
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7403 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80616145 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1689 (L1689P)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: L1689P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: L1689P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl2 G A 10: 83,614,195 A271V probably benign Het
Brpf3 C T 17: 28,821,356 T917I probably benign Het
Camta1 G A 4: 151,453,295 Q143* probably null Het
Ccdc129 T A 6: 55,976,414 L905* probably null Het
Cd3e C A 9: 45,002,292 E48D probably benign Het
Clca3b A G 3: 144,823,498 L805P probably benign Het
Crispld1 A G 1: 17,747,596 Y241C probably damaging Het
Ddx43 T G 9: 78,413,851 N380K probably damaging Het
Dtl A T 1: 191,563,173 V155E probably damaging Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Fam126b A T 1: 58,548,702 D117E possibly damaging Het
Fam78a T C 2: 32,069,615 N161S probably damaging Het
Far2 T C 6: 148,158,977 I276T possibly damaging Het
Gak T C 5: 108,613,535 K210R probably benign Het
Gm21319 G T 12: 87,773,544 Q82K probably benign Het
Gna14 G T 19: 16,599,081 D151Y Het
Hdhd2 A G 18: 76,955,040 D55G probably benign Het
Ifna5 A G 4: 88,835,873 N117D probably benign Het
Ikbkap A T 4: 56,778,994 C608S probably damaging Het
Il16 T A 7: 83,670,135 T383S probably damaging Het
Il1f5 T C 2: 24,281,202 F101L probably damaging Het
Ino80d A G 1: 63,062,219 V416A possibly damaging Het
Ints6 T C 14: 62,707,655 R409G possibly damaging Het
Itgb5 G T 16: 33,902,793 probably null Het
Kcnq3 T A 15: 66,002,217 R561W probably damaging Het
Kdelc2 T A 9: 53,390,441 V131E probably damaging Het
Lipo4 C T 19: 33,503,279 E230K possibly damaging Het
Lrrc7 A T 3: 158,148,674 L1299* probably null Het
Mcm3ap T C 10: 76,482,823 probably null Het
Mok A T 12: 110,815,129 probably null Het
Mylk2 T A 2: 152,917,341 V344E probably damaging Het
Oacyl T C 18: 65,737,895 V389A probably benign Het
Olfr284 T C 15: 98,340,119 Y290C probably damaging Het
Olfr335-ps T C 2: 36,302,330 F264L probably benign Het
Oplah T C 15: 76,305,009 D278G probably benign Het
Padi3 T C 4: 140,800,119 N124D probably benign Het
Parp3 T C 9: 106,474,853 S107G probably benign Het
Pcdhb18 G A 18: 37,491,897 G760D probably benign Het
Plekhh1 G A 12: 79,040,577 W13* probably null Het
Pou2f1 C T 1: 165,911,386 A166T unknown Het
Ppp1r10 C T 17: 35,929,434 P539S probably benign Het
Prdm11 T C 2: 92,986,691 T310A probably benign Het
Rbm25 A G 12: 83,676,134 Y777C probably damaging Het
Relt A T 7: 100,851,448 C72S probably damaging Het
Rhag T A 17: 40,834,658 I334N probably damaging Het
Rhbdf2 A C 11: 116,600,419 L630R probably damaging Het
Rnps1 T C 17: 24,425,087 S274P unknown Het
Rtkn2 A G 10: 68,005,636 I205V probably benign Het
Ryr1 A T 7: 29,013,867 V4690E probably benign Het
Secisbp2l T C 2: 125,760,279 Y387C possibly damaging Het
Sema3d A T 5: 12,497,584 I158F probably damaging Het
Slc17a1 A G 13: 23,874,707 N48S probably benign Het
Slc2a1 G A 4: 119,132,555 G130S probably damaging Het
Slc6a3 T C 13: 73,562,427 probably null Het
Snx27 A T 3: 94,528,926 S261T probably damaging Het
Spag17 A T 3: 99,939,375 I72F possibly damaging Het
Spink6 T G 18: 44,071,497 L10R unknown Het
Swt1 G A 1: 151,388,693 T690I probably benign Het
Syne2 G A 12: 75,915,246 E729K not run Het
Synj2 C T 17: 6,037,730 T1352M possibly damaging Het
Taar4 G A 10: 23,961,059 G189D probably damaging Het
Thsd4 T C 9: 60,056,887 N441D probably damaging Het
Tm9sf2 A G 14: 122,141,228 D248G probably benign Het
Tmem69 A T 4: 116,553,467 L102Q probably damaging Het
Tshr A G 12: 91,497,774 Y98C probably damaging Het
Tspan1 A G 4: 116,163,022 V230A probably benign Het
Upk3a T C 15: 85,019,508 V136A possibly damaging Het
Ush2a T A 1: 188,633,727 N2259K probably damaging Het
Usp24 A G 4: 106,407,035 D1721G possibly damaging Het
Vldlr T A 19: 27,236,274 C120* probably null Het
Vmn2r23 A T 6: 123,704,579 I149L probably benign Het
Vps8 A T 16: 21,434,972 E21V possibly damaging Het
Wdr35 A G 12: 9,012,685 I635V probably damaging Het
Zfp955a T C 17: 33,243,746 D58G probably benign Het
Zkscan5 A G 5: 145,218,593 Q358R probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTGATGGAATCCACACAGG -3'
(R):5'- CAGAACCATTTTACAGAGCTCTGAG -3'

Sequencing Primer
(F):5'- GATGGAATCCACACAGGCTTCTATG -3'
(R):5'- TCTGAGAGCCCTAACCTACTGAG -3'
Posted On2019-09-13