Incidental Mutation 'R4883:Sorcs1'
ID375480
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 042491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4883 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50232303 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 570 (V570I)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect probably benign
Transcript: ENSMUST00000072685
AA Change: V570I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: V570I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111756
AA Change: V570I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: V570I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
AA Change: V570I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: V570I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
AA Change: V570I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000209783
AA Change: V570I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211008
AA Change: V570I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211687
AA Change: V570I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,245,103 N52I probably damaging Het
Abca5 T C 11: 110,326,631 D133G probably damaging Het
Abcg4 G T 9: 44,279,319 H55Q probably damaging Het
Acaca T A 11: 84,251,290 V641E probably benign Het
Adam28 T C 14: 68,638,103 I229V probably damaging Het
Adgrl3 T A 5: 81,689,646 I793N probably damaging Het
Akr1d1 A T 6: 37,558,401 D240V possibly damaging Het
Arhgef25 T C 10: 127,182,933 D548G probably benign Het
Asl A G 5: 130,013,961 probably null Het
Atg14 C T 14: 47,551,314 R194Q probably damaging Het
BC004004 T A 17: 29,282,192 F38L probably damaging Het
Btg1 T C 10: 96,617,397 F25L probably benign Het
Btrc C T 19: 45,456,587 P35S probably benign Het
Calcr T A 6: 3,714,705 N142Y probably damaging Het
Ccdc138 A G 10: 58,561,996 I553V probably benign Het
Cdc42 T A 4: 137,328,804 N132I probably benign Het
Ces1e A G 8: 93,224,088 S22P probably benign Het
Clmn G T 12: 104,782,048 D413E probably benign Het
Cramp1l T C 17: 24,982,319 T730A probably benign Het
Dnah5 A T 15: 28,343,638 M2395L probably benign Het
Ephx1 G T 1: 181,001,923 S20Y possibly damaging Het
Exoc5 T G 14: 49,052,364 E19A probably damaging Het
Fam120b T C 17: 15,403,032 L424P probably benign Het
Fam89a G A 8: 124,741,084 T163I possibly damaging Het
Fcrls G A 3: 87,259,615 L24F possibly damaging Het
Fgd6 G T 10: 94,139,853 V1377L probably benign Het
Glud1 T A 14: 34,335,390 I337K possibly damaging Het
Gm6370 T A 5: 146,493,926 I303N probably benign Het
Gm7995 T C 14: 42,311,426 Y88H probably damaging Het
Gsdma3 T C 11: 98,629,567 probably null Het
Gsdmc2 T C 15: 63,835,765 D60G probably damaging Het
Hcn1 T A 13: 117,902,895 probably null Het
Hectd1 A T 12: 51,784,247 C936* probably null Het
Herc4 T A 10: 63,285,654 S358T probably benign Het
Hk3 A G 13: 55,010,922 C515R probably benign Het
Ighg1 A G 12: 113,327,518 probably benign Het
Iqgap3 T A 3: 88,107,535 C853S probably benign Het
Irx4 G A 13: 73,267,631 A180T probably damaging Het
Kif20b A G 19: 34,966,122 T1441A probably benign Het
Lifr A G 15: 7,185,625 K738E possibly damaging Het
Lmntd2 A T 7: 141,212,618 S218T probably damaging Het
Lnx1 A T 5: 74,607,869 W353R probably benign Het
Lrfn3 G T 7: 30,355,813 P569Q possibly damaging Het
Mamstr A G 7: 45,644,414 I11V probably benign Het
Med31 T C 11: 72,214,149 N32S possibly damaging Het
Mob3c A T 4: 115,833,731 I173F probably benign Het
Morc3 A G 16: 93,870,362 probably null Het
Mphosph9 T C 5: 124,299,045 K412R probably damaging Het
Mthfd1l C T 10: 4,007,775 P271S probably benign Het
Ncam1 C T 9: 49,541,883 probably null Het
Ncbp3 T A 11: 73,069,752 Y279N probably damaging Het
Ncoa6 G A 2: 155,406,767 T1539I probably benign Het
Nedd4 G A 9: 72,740,233 probably null Het
Neil1 A G 9: 57,146,922 V38A probably damaging Het
Ngf T A 3: 102,520,645 F237I probably damaging Het
Nol3 A G 8: 105,279,256 Q94R possibly damaging Het
Obox1 A G 7: 15,556,338 N202S probably damaging Het
Odc1 T A 12: 17,547,385 N29K possibly damaging Het
Olfr1241 C T 2: 89,482,308 V276I probably benign Het
Olfr132 T C 17: 38,130,617 T192A probably damaging Het
Olfr1535 C T 13: 21,555,488 R178H probably benign Het
Olfr243 A C 7: 103,716,707 I38L probably benign Het
P2rx7 T A 5: 122,681,066 V517E probably damaging Het
Parm1 A G 5: 91,593,916 T48A possibly damaging Het
Pcdh9 T A 14: 93,888,728 D2V possibly damaging Het
Pgm3 G T 9: 86,569,325 T92N probably damaging Het
Plcg2 G T 8: 117,607,133 G882* probably null Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Ptprk A T 10: 28,588,932 Y1244F probably damaging Het
Rere G A 4: 150,616,053 A1162T probably damaging Het
Rfx2 T C 17: 56,783,747 E391G probably damaging Het
Sema4c A G 1: 36,552,016 V414A probably damaging Het
Serpinb10 A T 1: 107,540,951 N185I probably damaging Het
Shroom3 T G 5: 92,951,134 M1410R probably benign Het
Slc13a1 A T 6: 24,134,357 S176T probably benign Het
Sntb1 A T 15: 55,642,802 Y458* probably null Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Sp8 T A 12: 118,849,070 V220E probably damaging Het
Spry1 C T 3: 37,642,719 T37M possibly damaging Het
Sspo A T 6: 48,460,822 H1305L probably benign Het
Tbc1d22a A G 15: 86,496,916 D509G possibly damaging Het
Tmem108 A T 9: 103,499,077 V391D possibly damaging Het
Tmem132d T A 5: 128,269,300 I53F probably damaging Het
Tmem132d T A 5: 128,269,302 H52L possibly damaging Het
Tnnt2 A T 1: 135,847,758 R87* probably null Het
Ube3a A T 7: 59,243,450 M1L probably benign Het
Unc79 A G 12: 103,094,333 T1119A probably damaging Het
Usf3 A T 16: 44,219,579 H1474L probably damaging Het
Vcpip1 G A 1: 9,747,198 T320I probably damaging Het
Vmn1r56 A G 7: 5,196,444 L58P probably damaging Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Zbtb40 T A 4: 137,000,930 R459W probably benign Het
Zfc3h1 T A 10: 115,410,642 L878Q probably damaging Het
Zfp286 T C 11: 62,780,629 D206G probably benign Het
Zfp46 T A 4: 136,290,481 C209S probably damaging Het
Zufsp G T 10: 33,949,042 T148K probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
R8463:Sorcs1 UTSW 19 50259810 missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50378960 missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50151220 missense probably benign 0.33
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGGTTCACTTCAGACTTGC -3'
(R):5'- CCACCTAAACCGTTGACCTTGAAG -3'

Sequencing Primer
(F):5'- CACTTCAGACTTGCATTACAAAGAG -3'
(R):5'- CCGTTGACCTTGAAGTAAGTCTAC -3'
Posted On2016-03-17